Skip to content

Navigation Menu

Sign in
Appearance settings

Search code, repositories, users, issues, pull requests...

Provide feedback

We read every piece of feedback, and take your input very seriously.

Saved searches

Use saved searches to filter your results more quickly

Appearance settings

shenwei356/unikmer

Open more actions menu

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

unikmer: a versatile toolkit for k-mers with taxonomic information

Documents: https://bioinf.shenwei.me/unikmer/

unikmer is a toolkit for nucleic acid k-mer analysis, providing functions including set operation k-mers (sketch) optional with TaxIds but without count information.

K-mers are either encoded (k<=32) or hashed (k<=64, using ntHash v1) into uint64, and serialized in binary file with extension .unik.

TaxIds can be assigned when counting k-mers from genome sequences, and LCA (Lowest Common Ancestor) is computed during set opertions including computing union, intersecton, set difference, unique and repeated k-mers.

Related projects:

Table of Contents

Using cases

  • Finding conserved regions in all genomes of a species.
  • Finding species/strain-specific sequences for designing probes/primers.

Installation

  1. Downloading executable binary files.

  2. Via Bioconda Anaconda Cloud downloads

     conda install -c bioconda unikmer
    

Commands

Usages

  1. Counting

     count           Generate k-mers (sketch) from FASTA/Q sequences
    
  2. Information

     info            Information of binary files
     num             Quickly inspect the number of k-mers in binary files
    
  3. Format conversion

     view            Read and output binary format to plain text
     dump            Convert plain k-mer text to binary format
    
     encode          Encode plain k-mer texts to integers
     decode          Decode encoded integers to k-mer texts
    
  4. Set operations

     concat          Concatenate multiple binary files without removing duplicates
     inter           Intersection of k-mers in multiple binary files
     common          Find k-mers shared by most of the binary files
     union           Union of k-mers in multiple binary files
     diff            Set difference of k-mers in multiple binary files
    
  5. Split and merge

     sort            Sort k-mers to reduce the file size and accelerate downstream analysis
     split           Split k-mers into sorted chunk files
     tsplit          Split k-mers according to TaxId
     merge           Merge k-mers from sorted chunk files
    
  6. Subset

     head            Extract the first N k-mers
     sample          Sample k-mers from binary files
     grep            Search k-mers from binary files
     filter          Filter out low-complexity k-mers
     rfilter         Filter k-mers by taxonomic rank
    
  7. Searching on genomes

     locate          Locate k-mers in genome
     map             Mapping k-mers back to the genome and extract successive regions/subsequences
    
  8. Misc

     autocompletion  Generate shell autocompletion script
     version         Print version information and check for update
    

Binary file

Go Reference

K-mers (represented in uint64 in RAM ) are serialized in 8-Byte (or less Bytes for shorter k-mers in compact format, or much less Bytes for sorted k-mers) arrays and optionally compressed in gzip format with extension of .unik. TaxIds are optionally stored next to k-mers with 4 or less bytes.

Compression ratio comparison

No TaxIds stored in this test.

cr.jpg

label encoded-kmera gzip-compressedb compact-formatc sortedd comment
plain plain text
gzip gzipped plain text
unik.default gzipped encoded k-mers in fixed-length byte array
unik.compat gzipped encoded k-mers in shorter fixed-length byte array
unik.sorted gzipped sorted encoded k-mers
  • a One k-mer is encoded as uint64 and serialized in 8 Bytes.
  • b K-mers file is compressed in gzip format by default, users can switch on global option -C/--no-compress to output non-compressed file.
  • c One k-mer is encoded as uint64 and serialized in 8 Bytes by default. However few Bytes are needed for short k-mers, e.g., 4 Bytes are enough for 15-mers (30 bits). This makes the file more compact with smaller file size, controled by global option -c/--compact .
  • d One k-mer is encoded as uint64, all k-mers are sorted and compressed using varint-GB algorithm.
  • In all test, flag --canonical is ON when running unikmer count.

Quick Start

# memusg is for compute time and RAM usage: https://github.com/shenwei356/memusg


# counting (only keep the canonical k-mers and compact output)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23 --canonical --compact
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23 --canonical --compact
elapsed time: 0.897s
peak rss: 192.41 MB


# counting (only keep the canonical k-mers and sort k-mers)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted --canonical --sort
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted --canonical --sort
elapsed time: 1.136s
peak rss: 227.28 MB


# counting and assigning global TaxIds
$ unikmer count -k 23 -K -s Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted   -t 585057
$ unikmer count -k 23 -K -s Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted -t 511145
$ unikmer count -k 23 -K -s A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.sorted -t 349741

# counting minimizer and ouputting in linear order
$ unikmer count -k 23 -W 5 -H -K -l A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.m

# view
$ unikmer view Ecoli-MG1655.fasta.gz.k23.sorted.unik --show-taxid | head -n 3
AAAAAAAAACCATCCAAATCTGG 511145
AAAAAAAAACCGCTAGTATATTC 511145
AAAAAAAAACCTGAAAAAAACGG 511145

# view (hashed k-mers needs original FASTA/Q file)
$ unikmer view --show-code --genome A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 3
CATCCGCCATCTTTGGGGTGTCG 1210726578792
AGCGCAAAATCCCCAAACATGTA 2286899379883
AACTGATTTTTGATGATGACTCC 3542156397282

# find the positions of k-mers
$ unikmer locate -g A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 5
NC_010655.1     2       25      ATCTTATAAAATAACCACATAAC 0       .
NC_010655.1     5       28      TTATAAAATAACCACATAACTTA 0       .
NC_010655.1     6       29      TATAAAATAACCACATAACTTAA 0       .
NC_010655.1     9       32      AAAATAACCACATAACTTAAAAA 0       .
NC_010655.1     13      36      TAACCACATAACTTAAAAAGAAT 0       .

# info
$ unikmer info *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             


# concat
$ memusg -t unikmer concat *.k23.sorted.unik -o concat.k23 -c
elapsed time: 1.020s
peak rss: 25.86 MB



# union
$ memusg -t unikmer union *.k23.sorted.unik -o union.k23 -s
elapsed time: 3.991s
peak rss: 590.92 MB


# or sorting with limited memory.
# note that taxonomy database need some memory.
$ memusg -t unikmer sort *.k23.sorted.unik -o union2.k23 -u -m 1M
elapsed time: 3.538s
peak rss: 324.2 MB

$ unikmer view -t union.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -
$ unikmer view -t union2.k23.unik | md5sum 
4c038832209278840d4d75944b29219c  -


# duplicate k-mers
# memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d -m 1M # limit memory usage
$ memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d
elapsed time: 1.143s
peak rss: 240.18 MB


# intersection
$ memusg -t unikmer inter *.k23.sorted.unik -o inter.k23
elapsed time: 1.481s
peak rss: 399.94 MB


# difference
$ memusg -t unikmer diff -j 10 *.k23.sorted.unik -o diff.k23 -s
elapsed time: 0.793s
peak rss: 338.06 MB


$ ls -lh *.unik
-rw-r--r-- 1 shenwei shenwei 6.6M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik
-rw-r--r-- 1 shenwei shenwei 9.5M Sep  9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik
-rw-r--r-- 1 shenwei shenwei  46M Sep  9 17:25 concat.k23.unik
-rw-r--r-- 1 shenwei shenwei 9.2M Sep  9 17:27 diff.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:26 dup.k23.unik
-rw-r--r-- 1 shenwei shenwei  18M Sep  9 17:23 Ecoli-IAI39.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  29M Sep  9 17:24 Ecoli-IAI39.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  17M Sep  9 17:23 Ecoli-MG1655.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei  27M Sep  9 17:25 Ecoli-MG1655.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei  11M Sep  9 17:27 inter.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:26 union2.k23.unik
-rw-r--r-- 1 shenwei shenwei  26M Sep  9 17:25 union.k23.unik

$ unikmer stats *.unik -a -j 10
file                                              k  canonical  hashed  scaled  include-taxid  global-taxid  sorted  compact  gzipped  version     number  description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik       23  ✓          ✓       ✕       ✕                            ✕       ✕        ✓        v5.0       860,900             
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik  23  ✓          ✕       ✕       ✕                    349741  ✓       ✕        ✓        v5.0     2,630,905             
concat.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✕       ✓        ✓        v5.0            -1             
diff.k23.unik                                    23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,326,096             
dup.k23.unik                                     23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
Ecoli-IAI39.fasta.gz.k23.sorted.unik             23  ✓          ✕       ✕       ✕                    585057  ✓       ✕        ✓        v5.0     4,902,266             
Ecoli-IAI39.fasta.gz.k23.unik                    23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,902,266             
Ecoli-MG1655.fasta.gz.k23.sorted.unik            23  ✓          ✕       ✕       ✕                    511145  ✓       ✕        ✓        v5.0     4,546,632             
Ecoli-MG1655.fasta.gz.k23.unik                   23  ✓          ✕       ✕       ✕                            ✕       ✓        ✓        v5.0     4,546,632             
inter.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     2,576,170             
union2.k23.unik                                  23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728             
union.k23.unik                                   23  ✓          ✕       ✕       ✓                            ✓       ✕        ✓        v5.0     6,872,728

# -----------------------------------------------------------------------------------------

# mapping k-mers to genome
seqkit seq Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta
g=Ecoli-IAI39.fasta
f=inter.k23.unik
# mapping k-mers back to the genome and extract successive regions/subsequences
unikmer map -g $g $f -a | more


# using bwa
# to fasta
unikmer view $f -a -o $f.fa.gz
# make index
bwa index $g; samtools faidx $g
ncpu=12
ls $f.fa.gz \
    | rush -j 1 -v ref=$g -v j=$ncpu \
        'bwa aln -o 0 -l 17 -k 0 -t {j} {ref} {} \
            | bwa samse {ref} - {} \
            | samtools view -bS > {}.bam; \
         samtools sort -T {}.tmp -@ {j} {}.bam -o {}.sorted.bam; \
         samtools index {}.sorted.bam; \
         samtools flagstat {}.sorted.bam > {}.sorted.bam.flagstat; \
         /bin/rm {}.bam '  

Support

Please open an issue to report bugs, propose new functions or ask for help.

License

MIT License

About

A versatile toolkit for k-mers with taxonomic information

Topics

Resources

License

Stars

Watchers

Forks

Packages

No packages published
Morty Proxy This is a proxified and sanitized view of the page, visit original site.