From 7be9a41e951d3be54349144eb990e0210dac9810 Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Fri, 27 Oct 2017 16:32:05 -0700 Subject: [PATCH 01/37] New test for #712, thanks @larsonmattr --- .../biojava/nbio/structure/TestCloning.java | 20 +++++++++++++++++++ 1 file changed, 20 insertions(+) diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java index bec887a967..233f7c1cb8 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java @@ -27,6 +27,7 @@ import java.io.IOException; import java.util.Iterator; +import java.util.List; import org.biojava.nbio.structure.align.util.AtomCache; import org.biojava.nbio.structure.io.FileParsingParameters; @@ -146,5 +147,24 @@ private void compareCloned(Structure s, Structure c) throws StructureException { assertEquals(allAtoms.length,allAtomsCloned.length); } + + @Test + public void testBondCloning() throws IOException, StructureException { + + AtomCache cache = new AtomCache(); + cache.setUseMmCif(true); + + FileParsingParameters params = cache.getFileParsingParams(); + params.setCreateAtomBonds(true); + cache.setFileParsingParams(params); + + Structure s = cache.getStructure("2I13"); + List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds); + + Structure s2 = s.clone(); + bonds = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds); + } } From 631ecb118655a6648ff6f79be06888129a29ebd8 Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Sat, 5 May 2018 19:26:51 +0200 Subject: [PATCH 02/37] First commit for ABITracer --- .../nbio/core/sequence/io/ABITrace.java | 521 ++++++++++++++++++ .../nbio/core/sequence/io/ABITracerTest.java | 62 +++ biojava-core/src/test/resources/3730.ab1 | Bin 0 -> 299987 bytes 3 files changed, 583 insertions(+) create mode 100644 biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java create mode 100644 biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java create mode 100644 biojava-core/src/test/resources/3730.ab1 diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java new file mode 100644 index 0000000000..509aa8a75a --- /dev/null +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java @@ -0,0 +1,521 @@ +/* + * BioJava development code + * + * This code may be freely distributed and modified under the + * terms of the GNU Lesser General Public Licence. This should + * be distributed with the code. If you do not have a copy, + * see: + * + * http://www.gnu.org/copyleft/lesser.html + * + * Copyright for this code is held jointly by the individual + * authors. These should be listed in @author doc comments. + * + * For more information on the BioJava project and its aims, + * or to join the biojava-l mailing list, visit the home page + * at: + * + * http://www.biojava.org/ + * + * Created on 05-04-2018 + */ + +package org.biojava.nbio.core.sequence.io; + +import java.io.IOException; +import java.io.File; +import java.io.BufferedInputStream; +import java.io.ByteArrayOutputStream; +import java.io.FileInputStream; +import java.io.DataInputStream; +import java.io.ByteArrayInputStream; +import java.awt.Color; +import java.awt.Graphics2D; +import java.awt.image.BufferedImage; + +import org.biojava.nbio.core.sequence.compound.DNACompoundSet; +import org.biojava.nbio.core.sequence.compound.NucleotideCompound; +import org.biojava.nbio.core.sequence.template.AbstractSequence; +import org.biojava.nbio.core.exceptions.CompoundNotFoundException; + +/** + * Title: ABITrace

+ * ABITrace is a class for managing ABI file information, + * it is capable of opening an ABI file and storing + * the most important fields, which can be recalled as simple java types. It can also return + * an image corresponding to the trace. + * It has three constructors with input types File, URL, and byte[].

+ * ABI files contain two sets of basecall and sequence data, one that was originally + * created programatically and the other, which is an editable copy. This version of this object + * only references the original unedited data.
+ */ +public class ABITrace { + + //the next three lines are the important persistent data + private String sequence; + private int A[], G[], C[], T[], Basecalls[], Qcalls[]; + private int TraceLength, SeqLength; + + //This is the actual file data. + private byte[] TraceData; + + private int maximum = 0; + + //the next four declaration lines comprise the file index information + private int MacJunk = 0; //sometimes when macintosh files are + //FTPed in binary form, they have 128 bytes + //of crap pre-pended to them. This constant + //allows ABITrace to handle that in a way that + //is invisible to the user. + private static int AbsIndexBase = 26; //The file location of the Index pointer + private int IndexBase, PLOC, PCON; + + //the next declaration is for the actual file pointers + private int DATA9, DATA10, DATA11, DATA12, PBAS2, FWO; + + /** + * The File constructor opens a local ABI file and parses the content. + * + * @param ABIFile is a java.io.File on the local file system. + * @throws IOException if there is a problem reading the file. + * @throws IllegalArgumentException if the file is not a valid ABI file. + */ + public ABITrace(File ABIFile) throws IOException { + byte[] bytes = null; + ByteArrayOutputStream baos = new ByteArrayOutputStream(); + FileInputStream fis = new FileInputStream(ABIFile); + BufferedInputStream bis = new BufferedInputStream(fis); + int b; + while ((b = bis.read()) >= 0) { + baos.write(b); + } + bis.close(); + fis.close(); + baos.close(); + bytes = baos.toByteArray(); + initData(bytes); + } + + /** + * The byte[] constructor parses an ABI file represented as a byte array. + * + * @throws IllegalArgumentException if the data does not represent a valid ABI file. + */ + public ABITrace(byte[] ABIFileData) { + initData(ABIFileData); + } + + /** + * Returns the length of the sequence (number of bases) in this trace. + */ + public int getSequenceLength() { + return SeqLength; + } + + /** + * Returns the length of the trace (number of x-coordinate points in the graph). + */ + public int getTraceLength() { + return TraceLength; + } + + /** + * Returns an int[] array that represents the basecalls - each int in the + * array corresponds to an x-coordinate point in the graph that is a peak (a base location). + */ + public int[] getBasecalls() { + return Basecalls; + } + + /** + * Returns an int[] array that represents the quality - each int in the + * array corresponds to an quality value 90-255) in the graph at a base location). + */ + public int[] getQcalls() { + return Qcalls; + } + + /** + * Returns the original programmatically determined (unedited) sequence as a AbstractSequence. + */ + public AbstractSequence getSequence() throws CompoundNotFoundException { + try { + DNASequenceCreator creator = new DNASequenceCreator(DNACompoundSet.getDNACompoundSet()); + return creator.getSequence(sequence, 0); + } catch (Exception e) { + // this should be impossible! + throw new CompoundNotFoundException(e.toString()); + } + } + + /** + * Returns a BufferedImage that represents the entire trace. The height can be set precisely in + * pixels, the width in pixels is determined by the scaling factor times the number + * of points in the trace (getTraceLength()). The entire trace is represented + * in the returned image. + * + * @param imageHeight is the desired height of the image in pixels. + * @param widthScale indiates how many horizontal pixels to use to represent a single x-coordinate (try 2). + */ + public BufferedImage getImage(int imageHeight, int widthScale) { + BufferedImage out = new BufferedImage(TraceLength * widthScale, imageHeight, BufferedImage.TYPE_BYTE_INDEXED); + Graphics2D g = out.createGraphics(); + Color acolor = Color.green.darker(); + Color ccolor = Color.blue; + Color gcolor = Color.black; + Color tcolor = Color.red; + Color ncolor = Color.pink; + double scale = calculateScale(imageHeight); + int[] bc = Basecalls; + char[] seq = sequence.toCharArray(); + g.setBackground(Color.white); + g.clearRect(0, 0, TraceLength * widthScale, imageHeight); + int here = 0; + int basenum = 0; + for (int q = 1; q <= 5; q++) { + for (int x = 0; x <= TraceLength - 2; x++) { + if (q == 1) { + g.setColor(acolor); + g.drawLine(2 * x, transmute(A[x], imageHeight, scale), + 2 * (x + 1), transmute(A[x + 1], imageHeight, scale)); + } + if (q == 2) { + g.setColor(ccolor); + g.drawLine(2 * x, transmute(C[x], imageHeight, scale), + 2 * (x + 1), transmute(C[x + 1], imageHeight, scale)); + } + if (q == 3) { + g.setColor(tcolor); + g.drawLine(2 * x, transmute(T[x], imageHeight, scale), + 2 * (x + 1), transmute(T[x + 1], imageHeight, scale)); + } + if (q == 4) { + g.setColor(gcolor); + g.drawLine(2 * x, transmute(G[x], imageHeight, scale), + 2 * (x + 1), transmute(G[x + 1], imageHeight, scale)); + } + if (q == 5) { + if ((here > bc.length - 1) || (basenum > seq.length - 1)) break; + if (bc[here] == x) { + g.drawLine(2 * x, transmute(-2, imageHeight, 1.0), + 2 * x, transmute(-7, imageHeight, 1.0)); + if ((basenum + 1) % 10 == 0) //if the basecount is divisible by ten + //add a number + { + g.drawLine(2 * x, transmute(-20, imageHeight, 1.0), + 2 * x, transmute(-25, imageHeight, 1.0)); + g.drawString(Integer.toString(basenum + 1), + 2 * x - 3, transmute(-36, imageHeight, 1.0)); + } + switch (seq[basenum]) { + case 'A': + case 'a': + g.setColor(acolor); + break; + case 'C': + case 'c': + g.setColor(ccolor); + break; + case 'G': + case 'g': + g.setColor(gcolor); + break; + case 'T': + case 't': + g.setColor(tcolor); + break; + default: + g.setColor(ncolor); + } + g.drawChars(seq, basenum, 1, + 2 * x - 3, transmute(-18, imageHeight, 1.0)); + g.setColor(Color.black); + here++; + basenum++; + } + } + } + } + return out; + } + + /** + * Utility method to translate y coordinates from graph space (where up is greater) + * to image space (where down is greater). + */ + private int transmute(int ya, int height, double scale) { + return (height - 45 - (int) (ya * scale)); + } + + //calculates the necessary scaling to allow the trace to fit vertically + //in the space specified. + + /** + * Returns the scaling factor necessary to allow all of the traces to fit vertically + * into the specified space. + * + * @param - the required height in pixels. + */ + private double calculateScale(int height) { + double newScale = 0.0; + double max = (double) getMaximum(); + double ht = (double) height; + newScale = ((ht - 50.0)) / max; + return newScale; + } + + /** + * Get the maximum height of any of the traces. The data is persisted for performance + * in the event of multiple calls, but it initialized lazily. + */ + private int getMaximum() { + if (maximum > 0) return maximum; + int max = 0; + for (int x = 0; x <= T.length - 1; x++) { + if (T[x] > max) max = T[x]; + if (A[x] > max) max = A[x]; + if (C[x] > max) max = C[x]; + if (G[x] > max) max = G[x]; + } + return max; + } + + /** + * Initialize all of the data fields for this object. + * + * @throws IllegalArgumentException which will propagate to all of the constructors. + */ + private void initData(byte[] fileData) { + TraceData = fileData; + if (isABI()) { + setIndex(); + setBasecalls(); + setQcalls(); + setSeq(); + setTraces(); + } else throw new IllegalArgumentException("Not a valid ABI file."); + } + + /** + * Shuffle the pointers to point to the proper spots in the trace, then load the + * traces into their arrays. + */ + private void setTraces() { + int pointers[] = new int[4]; //alphabetical, 0=A, 1=C, 2=G, 3=T + int datas[] = new int[4]; + char order[] = new char[4]; + + datas[0] = DATA9; + datas[1] = DATA10; + datas[2] = DATA11; + datas[3] = DATA12; + + for (int i = 0; i <= 3; i++) { + order[i] = (char) TraceData[FWO + i]; + } + + for (int i = 0; i <= 3; i++) { + switch (order[i]) { + case 'A': + case 'a': + pointers[0] = datas[i]; + break; + case 'C': + case 'c': + pointers[1] = datas[i]; + break; + case 'G': + case 'g': + pointers[2] = datas[i]; + break; + case 'T': + case 't': + pointers[3] = datas[i]; + break; + default: + throw new IllegalArgumentException("Trace contains illegal values."); + } + } + + A = new int[TraceLength]; + C = new int[TraceLength]; + G = new int[TraceLength]; + T = new int[TraceLength]; + + for (int i = 0; i <= 3; i++) { + byte[] qq = new byte[TraceLength * 2]; + getSubArray(qq, pointers[i]); + DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); + for (int x = 0; x <= TraceLength - 1; x++) { + try { + if (i == 0) A[x] = (int) dis.readShort(); + if (i == 1) C[x] = (int) dis.readShort(); + if (i == 2) G[x] = (int) dis.readShort(); + if (i == 3) T[x] = (int) dis.readShort(); + } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong. + { + throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); + } + } + } + return; + } + + /** + * Fetch the sequence from the trace data. + */ + private void setSeq() { + char tempseq[] = new char[SeqLength]; + for (int x = 0; x <= SeqLength - 1; ++x) { + tempseq[x] = (char) TraceData[PBAS2 + x]; + } + sequence = new String(tempseq); + } + + /** + * Fetch the quality calls from the trace data. + */ + private void setQcalls() { + Qcalls = new int[SeqLength]; + byte[] qq = new byte[SeqLength]; + getSubArray(qq, PCON); + DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); + for (int i = 0; i <= SeqLength - 1; ++i) { + try { + Qcalls[i] = (int) dis.readByte(); + } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong. + { + throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); + } + } + } + + /** + * Fetch the basecalls from the trace data. + */ + private void setBasecalls() { + Basecalls = new int[SeqLength]; + byte[] qq = new byte[SeqLength * 2]; + getSubArray(qq, PLOC); + DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); + for (int i = 0; i <= SeqLength - 1; ++i) { + try { + Basecalls[i] = (int) dis.readShort(); + } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong. + { + throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); + } + } + } + + /** + * Sets up all of the initial pointers to the important records in TraceData. + */ + private void setIndex() { + int DataCounter, PBASCounter, PLOCCounter, PCONCounter, NumRecords; + byte[] RecNameArray = new byte[4]; + String RecName; + + DataCounter = 0; + PBASCounter = 0; + PLOCCounter = 0; + PCONCounter = 0; + + IndexBase = getIntAt(AbsIndexBase + MacJunk); + NumRecords = getIntAt(AbsIndexBase - 8 + MacJunk); + + for (int record = 0; record <= NumRecords - 1; record++) { + getSubArray(RecNameArray, (IndexBase + (record * 28))); + RecName = new String(RecNameArray); + if (RecName.equals("FWO_")) + FWO = IndexBase + (record * 28) + 20; + if (RecName.equals("DATA")) { + ++DataCounter; + if (DataCounter == 9) + DATA9 = IndexBase + (record * 28) + 20; + if (DataCounter == 10) + DATA10 = IndexBase + (record * 28) + 20; + if (DataCounter == 11) + DATA11 = IndexBase + (record * 28) + 20; + if (DataCounter == 12) + DATA12 = IndexBase + (record * 28) + 20; + } + if (RecName.equals("PBAS")) { + ++PBASCounter; + if (PBASCounter == 2) + PBAS2 = IndexBase + (record * 28) + 20; + } + if (RecName.equals("PLOC")) { + ++PLOCCounter; + if (PLOCCounter == 2) + PLOC = IndexBase + (record * 28) + 20; + } + if (RecName.equals("PCON")) { + ++PCONCounter; + if (PCONCounter == 2) + PCON = IndexBase + (record * 28) + 20; + } + + } //next record + TraceLength = getIntAt(DATA12 - 8); + SeqLength = getIntAt(PBAS2 - 4); + PLOC = getIntAt(PLOC) + MacJunk; + DATA9 = getIntAt(DATA9) + MacJunk; + DATA10 = getIntAt(DATA10) + MacJunk; + DATA11 = getIntAt(DATA11) + MacJunk; + DATA12 = getIntAt(DATA12) + MacJunk; + PBAS2 = getIntAt(PBAS2) + MacJunk; + PCON = getIntAt(PCON) + MacJunk; + } + + /** + * Utility method to return an int beginning at pointer in the TraceData array. + */ + private int getIntAt(int pointer) { + int out = 0; + byte[] temp = new byte[4]; + getSubArray(temp, pointer); + try { + DataInputStream dis = new DataInputStream(new ByteArrayInputStream(temp)); + out = dis.readInt(); + } catch (IOException e) //This shouldn't happen. If it does something must be seriously wrong. + { + throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); + } + return out; + } + + /** + * A utility method which fills array b with data from the trace starting at traceDataOffset. + */ + private void getSubArray(byte[] b, int traceDataOffset) { + for (int x = 0; x <= b.length - 1; x++) { + b[x] = TraceData[traceDataOffset + x]; + } + } + + /** + * Test to see if the file is ABI format by checking to see that the first three bytes + * are "ABI". Also handle the special case where 128 bytes were prepended to the file + * due to binary FTP from an older macintosh system. + */ + private boolean isABI() { + char ABI[] = new char[4]; + + for (int i = 0; i <= 2; i++) { + ABI[i] = (char) TraceData[i]; + } + if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) { + return true; + } else { + for (int i = 128; i <= 130; i++) { + ABI[i] = (char) TraceData[i]; + } + if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) { + MacJunk = 128; + return true; + } else + return false; + } + } +} diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java new file mode 100644 index 0000000000..96a89d9ad8 --- /dev/null +++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java @@ -0,0 +1,62 @@ +/* + * BioJava development code + * + * This code may be freely distributed and modified under the + * terms of the GNU Lesser General Public Licence. This should + * be distributed with the code. If you do not have a copy, + * see: + * + * http://www.gnu.org/copyleft/lesser.html + * + * Copyright for this code is held jointly by the individual + * authors. These should be listed in @author doc comments. + * + * For more information on the BioJava project and its aims, + * or to join the biojava-l mailing list, visit the home page + * at: + * + * http://www.biojava.org/ + * + */ + +package org.biojava.nbio.core.sequence.io; + +import java.io.File; +import org.junit.*; +import org.slf4j.Logger; +import org.slf4j.LoggerFactory; + +public class ABITracerTest { + + private final static Logger logger = LoggerFactory.getLogger(ABITracerTest.class); + + public ABITracerTest() { + } + + @BeforeClass + public static void setUpClass() throws Exception { + } + + @AfterClass + public static void tearDownClass() throws Exception { + } + + @Before + public void setUp() { + } + + @After + public void tearDown() { + } + + /** + * Test of process method, of class ABITracer. + */ + @Test + public void testProcess() throws Exception { + logger.info("process"); + File file = new File("/3730.ab1"); + ABITrace tracer = new ABITrace(file); + Assert.assertNotNull(tracer); + } +} diff --git a/biojava-core/src/test/resources/3730.ab1 b/biojava-core/src/test/resources/3730.ab1 new file mode 100644 index 0000000000000000000000000000000000000000..6c2c6c43b9d48262633e00f9c5d8d410f7462dbe GIT binary patch literal 299987 zcmeFacVHFQ)%H7k=7`=gn2r!2iV&!PXrc&^=paC%H-Q8QHIPKdxW#tj`X+JgIEmvH z_ilp$(|ZxUiQaqf9nSZAW{jQUH<$Q+_pcicM`zB=p1s#zd-b*UoS1f<rJ)&RfxK zCTFAvPE5(pNzKY^6%^huEGRG~b7WR>YUb!xL5T@*q0NEFu*JbCXgtQ?dh-vmRV)6_lGjAtfjPy`VM0d6l#Yp=I|Tg%Pef4be;MhgtC2xJGuXd$=8fJiDJNxQQhIty_TP2c zCnYzRiRS!6m;c=UK_l*qPs(O0xlHn(8};Bk4JIa~Pe^IqwOzvzBgaKI^1ekk`ti1Z z?V&?T&dBW4ak*gs$J-Oeq~-+jKX*(@U~ z(ZLJqTY`{~*)@Fxs342&O>ost|lDm6VNCvZ|~dV1i9l)#bM zDM`7UO&X;MPRQYpJL**0sOOxdi5%r5WsK8Z4>h~)StC-@Q*)=pG0;C@XqaFhCTNGb zz&Fgu8u4&_Cgokd&Lmmr;L@ z!?1>757kMJ_OM{Di3yNj&X}z9!6Uam{-rgvUho59<=!x6^>B-7>n2 z9T3)|M?!ipLE0{+UFVn>_b}G|Uc87tynpa@T3iqJxK~UcW~@VZhH;uKH|k&Sxb(RG z`p)%sKOn>Fv2zT)xmR>?VE=^hW@<*G2V;5z_YR9o?B%v=m(VA6UL=TMQt(v~O3-+KlcgzHx{<$&T^AGXoL2nPy z^dXx3|EahCi-O}P4e82@oPQ%g`s8Mfi_c2U{7H&FoB)i$)Jhti(q~-KNL2HW;^ATC zXP?}p?A%{6uBO&AGo@SB$fSR;HGUrIUnX~BGm|yU{{z-ya^u_g7W#gi{KG3i-4-MB zq{oDe9zO}!hwq?!(&T@=di$ERew9dt%XWMd@$h>0dY zOU(Za%+KE&{-4j}A1Cq9b`VH(?@Y*&HvbX$@QARV2jQ1dQ}@)#DK0(zJ2n&mKQ;Uj zl!qsXJ}D!!@NKfE#HS>s{i|6L(d2(IY<}6Celi~a4U;71q+mXbN=?QOOZlairaJl2 zQvKI?Jv@Tws56k{rjAPWL`Tn2J>*CI65^+?-YKI}vNf@U?9_~mzZZcI4^muec22G+ z@W=IjNG@jlZb|=i>qArhzueiR$6WQztqg+tVzEB_Lz(jsrcr(sedOo9}eyZcTV|bW3%er z!y~&V<)l3vx&1QMZr48k-|#e7f5z2#=qSMtxBrV*Q8TcKOHF_0+XuSjhhE9~S(^Bn z$^CfhK`5tn^uL_a$Zm9}b&(=T?P?`7j~jM7XmG1uxiLLLJNAmIm)Xs1Ra&)t_0U@D7GlmT8*{k*7j>9{3 z9X51W^o;mH1EZn_bg$EOVnRq<<64PBhV)M9R}e1~rWAHKWmx%x+0xHQNU@PMZ?jCpEoqof(7US~u@BV%Wrp zxUMOEn#@Rz$Z9sZXZF-#>0P5Dqigq0jcDAjfB$ihwH-OAW=8$Qk%9dZM|W+}YEX-y zDN`qgWJhLoiAoRdIec}!*Gd{4_$kFw?G|tKmADlKle9V;5eHw@MZXRsY}yo!+J)wX`7rgdPG|I(AG`s#wCob zJ*|8FnDHZGlRGwlZ0w8{ou-cK*Eu3`V9W0D%{z|jF?!6Hsd3pU!@GB_KVtNhpk|Fa zcF9if-m+Pp)QD+ga~ifD9y7J)xcGhv(Jd!5ZX47$xqkB0xWP{M!(6VF9)RaL{ z8H4(V$99NqGkEl4!*Zj#MK_Aety^bH)cl0B{E_>|zT#My#-Hjm7yQ)9%G zPN_+wo2O5xH?3D-Vt7_|V)Ufmfz8@xb{y9yws%&)F&W(_){pPnc6zT`J!3nK=s!59 zU8oCv@SrJ?bpwag$s9d8D!hHO7&>r#kNzRehouDe4R)8dTXasJq$wSG*BF*Cx#qOsT2oRYf|JL!>^w9k zGox*0W>9PzbRRsTR-gX48IwbrcN(2JBBV#-kg&{2X`Q12L*gcNpISREp+?Tsp~E|m zYTju4r08Cw>xQJ|G;h;$Xq!$05++R_GPYaSamjHRGg=NB**&92MElVlrw+|*n$*5c z*OqPj#r16+GdU%ChzN7wfM(OvhV^b3)2nr2@2EC`Im!J3<65WHtT(;iknUsB(i?Y5 zY&@i0{OH=l+b2d2PHZy0SxVEKkRhpU+c!vv8Q*eZX3O;Hxj`v0U57RZ%Wc`M!MKRj znjM3CkBpB@8Q7^^QpkvAvADTi>i0`++_B@}$C3lPHyPG;TJVtELH&cXlSArc)|}Kn zxktu`k(u#noyWE5^aEkK$eB>H!Q@We+N8E`7glFRX79}YZDae^ib#untVQeKfup-M zZIPQkeM;T_19GMfs?%#g!$G7(HPbq`9uXEdvQMj4QT@XsMh_a> zZ{+CMUK#ZVM5Q)v+Aw;=ptenOrwxl5*LrHh!NckdniNyBSM$UMbl)|5NX@QUO~&_$ z3m=vc)jKAvU(+ew(nH7AZ8xLe(D0^74aW@4Y#ZCPNqTxla;^SxwR*PcJhp{PIo*54 zCAJ^{an6?v>>-QUyIIQ!a4#}e%MW;-yn;4wcrBSE) z6Rb+u+s#A6BSOO?10%v(gf(pu86FrK)~rQXnE%*+U;o9xe=+c14Ez@Z|HZ(6G4Nju z{1*fNZ!yq<2M8%_6J^pW!*Vf$d`Y#9D>gXJup%A#36H`!88VE#tp$S^j(eyZ-A| z0n7H^@Za&@^53-zTLt_VIPdr0_FtqBq=4nnvNYHIT($XLk}J3Um-&9*f0b*7<2&?q zo44P8g?n}P9jgf6uhOUAf8BqPJMQ|gFb;R{K2Luab(J$W8TlUXOPsqwyL+_ob4?Ik zIiyXe10Z`Zg_-|uq$hx@q#%>L7iZn%2if7XAT_V<4n_a?ocq0L!dSN$g~AF%jo zd58PY^Yh{<{tHWjk|98&+)p&^~;t6443?;cwghpHO`&nebw#d zHa%Y8+coaLz$$_h=39`n*Ma5|{agW`g7FOBukpG>yX*Y*)8kFv=V)=mzn^UIAyVAj3Yxa&5betN#<;#&6~<&GzW)e!XcaYQWe$~DI2L0aRB}jx*^>V?*_Z6T9 zlU5@93SE6EPY+)^8{DV zbN(XduLyRooa6WaSh@i2FLU**JBrp)RC3yXh;zqz3!amVdxrTO<>%Z!=-j2}r7*|fa{obYZ zajxI|p`Y{qJwISbG;xyid%^uV;M7=`x#z4uADo<{XW{D*^A(Nge)YJIv*&4X(w*5+ z?!5pkhdC=)ZgBTL+Mjbr+YeMHXnljL`)H$eKIQgs1_<}l{w$;K0*jB|?iCt24+ zT+64|L)zK<2hukqGD-N+@qHRfa@%b)#I_pApknf_4Q(RxivF4~59ObozR)R><^DJ%hx#mfd z_4FvJ%BQbhMn#V5w9)s=#?;g$x%ZK^Qck#LdxTTGR$^Bf{yhP2rIKPiJT5YYC zbdBVZ$3LP|tk_@_{d(Lo9c-K0rw-fG>u1WhH zWH!5jbthK^jn?u2XAbc#pSJnD4)eK-zq^=^@F;59$9pHZ_VlpYNgD3tnr0x}9^z;V zV@ST80P?l;e9Xn=LFh;L+{v{aymg=OAvlF`t&23yUZ_E|Ctlh~Pm&d)vh^-3hk<$< zXLd2pNk)?V+0H#XITBBbm-09xir&rHL$vqC5dH7roV1A6LTezdI>M)p_5iKuM>r9j zIu;b-GSP)b6m@Ooa~CgN+2UWry~3l~Z=wAG#ugUEXHgH8!MkDJ!tGK7d`92yLURK6_5!!4ax3!^j>Js|nZphs)9T~{$tED&MKAk- z(4&uyT=gh^4@aB1ThcMlo%bGQA)O&9A=#-p=W+jb`ci-SjIoP8w?m2hn4S96>g@v# z$=)5nxRZHFa_r@*WV+6(jj**BtncBfteMSVb{FRa!477zgswqohw@3JwT#S zw(ypm+{$&qCGJ_r=T=@D8C~*!D_1u1UJay@vpX1J2d(nme)4E7zFN=sOphjQ+4 zgas{+k#BeXH(gKZCJ@P!l_iVS#Fd+TmtS?0d(R_b?z(qMr^~067j=UkVgOCQn_ z@(XXdd?0&M*06lU`#^(NMccxE#F|~8b{v34R@Xe;Tpkk-+#{vV2qnqIpP4u zDrr5!m2z-WWveQ@7HHLm_o`XJe6MK*S@k&^Wwo)ISnaH~RwpabO0&jV0x@A1T)w? zZYG(J&6nncId2>Ni;1@S!<6q$9juBFB#S-tDDu{g}Am=*J{M8ffa5w zvsyE|Fpfj4##Sh=W_+tci%_c}uLjJ#AsEmd&1u z`7FRu1rLwwYm7DAiiRdbTneqrTXjy$J9X0RFN-UzTeY=SzXrLT)U`??$X{6BR;^x#!Ed zvn@p{pH&9_E)V`|y6aw<`>QeMD$JpbRhes5=&!U(1;y#7B=?tL+#1ZkD043hMydfx zIWQW;=oM&RmcA-;wmfHxaz`=FRN%gH+*y+QDk4`3g0(8FV11;+o0i{O{dmW36=SE9)YZFxRece`DWrVw?s}MSB5q!kA}G5$k(vy44e&4F^uGWhAgfLRCrD zU#*j@)>CG=?c?6^$dqkxPkZYql%GwD5N2G)Dg|cBF%QvCA!O9)CK7qcz12VOpG?%9do|(+Y`|ZoV?t?I_yi+CA+?<`^7N)mm!33VlZ~k8+H|s<~K>Mq0dP zEi{GUq_@o_bJE-~>&*M6w{_K;Y5g9$l>DlRtSQ1uXijyIcKxhptXbA|aQ=c>3k9CC zAB9H$W^#}pJxqp~h0N&*6&FDgKVomPbKuJtO^CG|eD>x3Mo58L^jwdAB{K(FFI%4& zi~gpY&E~9an_XrZ$35WFYC!g~Ic|@!&pCsgr+B3}CG4l|0P~!w!3t$ry?`ka>Zt|I zmvz_42gMSJMzcx(?cpuGDDUbjy6PTBiatn_NsoDPPemluZyK82_VZ4xbKdt?-+JF# z-!$ipQ_~(}79*jnn+R5Dqg~T}%HCz~wzu0e%sum4)5uz2{m#W#ML4Mv)Z&9a%EKi^ zc@<>+%0M-eNu?M|yj>Vdvl;t5ZzAyS945Kw%js%Gzzc>(WzQXkE5TA;~l#y$$!?!%kG}ihKpVIh=FEv&>60 zB)d+z4A=exBj;&(gZbUSMuQr`4KZ$Eidk8%L@=ThR;&;ZRe=w>A-^}9Omx{XXO(Y? zZf`q6V_5w3@ZB6Tmd76Tz+d~ z-L$?$=XQmE@phn;BH&z^6)aKStSC6Yt5x9h0^D(#*Cn7U&O8ioiib3NSO*k&@1n9o4H)LI(vG$rU z^G909iqviBngJ7SSNiHvQG z3<+dS%K}vcj(S*swChN4^hysm>z%lHD5FY^>kHOATmUkad#%d<82W z`s3J(eJkcBJ6^HxTdbg3DMoaIcFNJn`n~5`)#P;O_yT0p38u5-n{Y4zk_igg=kSH-5APM@}MOd~Vd z4zu?=ANrzv^L<-=U;C;$vG)HUJ6|>f%(J$!-*I|5r+mNmE%SZlYvfEr_f<9>u#uj@ zk_!jF#leX3bnZEXU^_prJ{?C0!MI~pA}%oMafK?BCQ7H0)$ycF{+4)r?ByfP~| z*!t3xGqde}PATVOU%0QMbH{np-hvK#%-U%^2W3QH1(mSMLu>NtEmlr+FON+WehfGc zuv&^rD<`HkR>Z^0%qT)~nl;5EW4suwgs)5$^RZpr{=mNH1lnipKigHzToY!Uz{Wmn zT9~Ew%jmhizBax@UnOYtq8)2q!;by~HgqiVtAhB)m7f9hESVs^be0k1b4l)9U`$2( zZiBBwc&F!p?;_uig0};_6z@?UK>3!F+;xQ>knYeyIqaF~)`!@%(Iyq^F%8}+X)UuJ zM%p=Xvi1YOUpN}4DzZ*e zOY3+Wd?{L@tk^Lq-pl1Ex~ce>BI4d(@xwJ>vlvVHPx5Za9v^mf5;pl>Ji9i$dYAxf z3vf?@JA#p;@_FP7RC4Luf-ilnd?~T%@t|wa`j>aQn0W_bM@Ly zW_KAZ-GTZPfmN(o*&uoJiX|$ut0<|L3zV0uT$Hkc$`0Q{(?sLpEiyH*v1j5HZDI}k zm_pb&snAm?G}K+_u&7H<()Lg?Fct^T$=3U(fEjAmU<*2S8MDPqGqv!3cA0wSc{>s- z=!|bpK=*)`1Dg0=aF#-;mGC~BnabuRbH`rjr1^qzhWi(!GpnViMRL+$^ zxz-$b<|VtH{k*-GQS!Oh!NzF9eB;e0_DCnfSHSmPK-GY{zIS{joO>P*J$~Yg`=j~zUYf~LhJ=4{%vQCO4jpP}L;>zIBWLtk?rKg!qc4<8BNAND6 zH-XkhYX(wZ*0d~_3fxr;%R*LEVOGBu-12+tiWzR^+a2)NXCf0ip`9lJLm?9a92L>^ zZ^LEZ`DXk2JI9=IaN2vOgLxE4p99KgongM>zRtdu&N`=yJrTb)2nrvESKPq0#VWIE zvQNZ+%6Th8hjkH9r7PVerWm>WtHvD@N znWo%|;?l}Yi<=MfRt11^FDKvx<+VhG%A0MWg(CKc_*4u@xk_26l9Y<=da?SG+<%(m zqe!Kb+$Snlf65aIV)3A|vgG4|;uaD`c@X8k&oT$)nw6_nHeNLXvhbwg(7l#V7d)O3tvqF@7_`RCc}XC+xEJE6B({It!c+obE_cpBZf) zMINL;LG@YrBCdpz#UvTUDge75cz>`Z-B_3^Ae4dG$~>iuiD4mS6yd!Nq~dwW8scWG zi)>2S9kObaPg17X%bp2~ikKZkPAC($lk3Xs32S;Q)~zVJytK;1rQWg5VWIa#qjofb zScv}vJw@a5s)j`Qvtx`c8~QeVoJGDUdawAT;-5Q#MRIa8f0aK~j-Q+___Tppbsm?Q z!8LfMFz4c}U*l7yo6~k0k*mx05T%=Gke)TMUzD5x%8W-1m=Ddz737HK_Yb(9ae>|#?k)m|6+1Mrqtw{Qn2Ye6?t zteK`LR`2^ri5=!cXtS<$8){yKJWfN_U2wMf_6AG|_#$ACZ>DqDK4O z%Rce4ld?;wl|j0OSi_L>N8G5_Cur;i_`p%z_4DQ7N@PzLHOxY`U&=Cjh`9%U+(eN_fz540e@68~JHwX#pU zUCE}rtylA*ss>3)Wh0b#lP$M_e$McHAAG26uB?;$P+1}7=flqEW4&w2nCi4V}f=vB72A{}1jUzV{vSH=HT zzoT5BGE>S(UjR=;@L4fGt?=d1c7^dFGpyr=h?3LYH!2`3U}?bBfIs>UI2Y}U=CbKz z-LOs*aqfgIQO*7JS94VvR<-l$8kDa+>Qc1&k}OfiTT)orQB}Q2FL+gA$GN6F zma?ScDOEqnLlxzz4(TLNtOP?R!Hj763g0~nRo*WT+$cM^lKb~^RhT|Z@5*gc{fOj@ zCQi8&E(*bG8v+fMw$|Z;_qM{3b&83IT4j@~Do)Z{+30=DM)FW}u9_Ot`D@Th`NDNnN!uy>;oq8^f7wPX9U$VT;;5C@yZfz0v6>; z*Kl<+7*#Ema?ktVk#g|dQ0p7wnB&Y6yp?-oR^EU!u3LYDA17JwAu*q^YZIOL#uw;I z^~E{)PA{y~KVyOY84Vc-9#s9R5mhm#+JVm{j!3MrV(2p6^OP8Q)D`D<{c*65U*l*`*Ti zkwm%5{4Ue8XKhLEDXYH@8WfD8c~QAIQ?(JB{j1<;$xg`wNl%ZSRf(bXRxWoVZN>fT zc^_b9Ho!9*{mY!u~A@WU>rp z$4L7K&K1C=7*``AgY!)|afc{-mVMi?$uDMsfkf=H=ZHZ+VwGTS=UmuTH}-&od$y=g|G(HDT}R#rLeVc7wybvw+gM4L;% zmDWu4R?1SZ=2&}0(+`R9Q};ZYS0sg)qDeN!Gi4|pYqj&h_5Emd;J2A2%IfmI%W9oEbB>pPNpyGN$6IgzVx$*mQH-iLxU zGCHifSGS{_y|V7g=}VSNR?9-#%CYEDdRn!ORQzIx^uk+QZpxc6c*`@%PGp-#))6u< z9jtmTr>HJexR6J%6Wp!>w$1*z^!^1^1z-E;b7m(;vPVy_BC1?E$LD4jeqmEpFdMmB zvs8uARv=Pk$0jI7l|-ro*v(siC36lio}gF7lI(iP3y&6sk-fm6mC*>I={#m8nQ;!R z>AvIKwS||g16YF@NT|b=e-7^zjJt%ls!#;Y7GTQ*-Ytx|k<}LF#a~;2NfLE8*R=wo zDsk3g+8p%Hrq>1jh5kjnS96cru7`r8Tet9*CR0t7ICLA|yb37Mn`%3yYbBjjQ!8vr z8yzNUQW!b;jCI%yG>ggE{*gT93VQ}IwYNn1?3lXWauQPow`U zfB9SmeUktj#NrsA8jqi=IH9&d2Jsbw;WLqAV^rw1|1ZTMKSWP6xJb`PhZ^C!Ho zYtAQ5KWaBBn_roR#2HFsWvsSGkpB#29U`34_H^eHDt|t&>uWEO(`xBwu4%UOP%1087tAOpT$f+#Gt6)a;&e)eg zPy(F3OoTg-xYt)^tC_B7#$MHuBEDW7t~BR$;B7~>$9k$yzO}319}ch^ znyd7XV6CM}p&Q<2L81+cd*6o3@yhT-w3{dh-8|jO!%tXgx3(W6{xOfLl^FB6X#p2M z2^MPMj}?Wov?oQr3^^$LxtdgN{DIkjY(MT)BnD*@|2yPNx98Y_&{s+8b)q~~ zJb!Vrf_sR(j|bbe@c0Wsr5FAC!HqPUq_*dAp1^mkju-z|>jE_ee>1o7i|;f0*N}XN zs1W+fT0=DOO{}5cI>nvw&N!!?z0%G=60{@E`!tdJimcOR)_E7)FMC=w&Rbm#wE%xk z7?a#lEw{X3qIg7Nf{8Nz*}6qmSKkKW+w9VEoP&gXR5&Hj_>*%dSN&*le^|7bq?QS`<2C-_zb%* z4f|~^G4&jCm#T$N?2qh8VjI8-HM!t14xnX1cEmQ;B#)gIi!YitAmY&QMylaD(KeN}v~`2ONcN7~i3 zQ^8)mJKG)BZ6dUfyZxSocb*077l=J3qH(GcSux5#B8kbj)B8nyu_|~F$^(rh#`Zg> z7&URPP!U&~?D1{$G(N~HWOeE*^U55wuS)tr9>snrawRnRJ#Tr#l8mzZws9n@T2-Ik z?i6VV#ciYk$RjakFn0YcEdMcPnO(!~XZIx@e;Et5u9XMBc7%S4xS3x?L9}m3F_gPt zE(n|VEod>*u4Iq44>}F(D@2u&$=mm{PN5q*vyKKx6}8>R9JSL+)|={QRnff`xFmbU zZ(i-^9(1d09a(SEcdCpP9dF^To$!)u*bTH0C(3$T3HNxsuNZ-BBH41Dm#4n-=+D#3 z$B8nRAkNYUd-h9f30bR^M2CLG8V53 zmnSD{K$Yk_(XE1iE7s{^Y?-x4hYj$=YObkLS9YXqMcIjhN*>=D?%GUSdAXX~7VcTj z`IUT^EhovNn%(ulyqNR*xl5JV8@Mi6q-cqvl(KEtxKc$nuQb2B+dSHCrVm+E>uK>o z4=x81*^Zms(IjQmZVPW|P}#Mzs1>Q%1}0Vetk{*>cs2O4a23^)hbnm{8&|&79(?mh zp^S7Q2jS)oJCw@KVa^I?k@IJ#ul*alf|)@q=@sg=nxbLYD+HY?tL#~+vU*R`qk59% zA}J>yK+#iG>XbwqB)}){kUPIgUcEeV$|J;>-$wH&0^Q2&w^QtWRC>McyxAH68Tc8C6@4ZKR`6)r9n-4&H=W;PmM8RGg-c@}(k7isZ^*+@)vxp~W^ zm9F?=L){57F;qxT(`@m zpEaCc4z;axCCK-jmljeV@`)CLr`4{uTMI2NR!o_sC*^&uI9CZmK(WiEwRBoC|)fWy010(2CLi=R9i0k-^2{%`>)|x z_VOm~7B`4GwO>LJ9mQ8x@lDY)=^;fRWlt-6eHTg8oqWjaMA%CaLysdOUYV@dJ~Yw> z>Xd7d;jL!BPfUH8bJ@AY-$eU!vJ6ikt=}VO5QXk22o;lIrax7K-$v&)aph(?^A{o} zW9%(tLrzhD7>}nn9qs%Dyitp6gR0E5FIAFH7QK8gNie~`lJ8zzP!_uU1np0~j-={q z<)WL{Qau<(ZF3W138$=Yh-UXE9<1Hh7n!5#S(KZ4;JwLD$mfbG`?Y^hl2e&2@-aZ$ zfS8~ zMbMErT~P#4WgdSw;rWUh87>O{v*l2wO~&2b}7<*39*&6 z(3~W^s9YX~A`6=tdk&uUQqGFQ^4wm;SG%}Zlqgv$-%pVo`R=+$yE44Hce*nC2$Zk^ zcsx0;4Ae^A;;oGw$pg{u5XDv&(S8MeA7Z9UI4j;-z_Hdzvl6#TdmLrd4XnZj_l)MU zlveTw)sO7hee@*xu56dATk+i*zG>Wi_j3(rMVX4iYkY54h_|oElc5?ZkGDKAX%Owj zlV7jBWzxUe19(i?2P!&qu)gxBp%{SgG6BvDCC~LSc5A#YA|1K?S433<@u&#_hlt!6}&J|&-9hxpXvP}5W7v4XIMR}gPo13mRIf3hF3N7+ZP zpGsnrykHlA{#sazuxESV570s92e#jpT>oL(;QrIU^mbNRfC}T1r%? zsO26ow4XLwaamll4HSXjN`KNTCx{6K;I9lK>wA{EheY!9e<8aw9;@OGl~I#iyP^p5 zmweJ*JXtW>U9*kZ>sS#2#W=jklq8)fO}>btL$Wu7rFD#}9de4_C?27Rp!g&YSQLfR zK1_B$Q8CaO>2VZZ+lyVi(;0;3{Kk2XI_Yd;Hq*&AeT00hM|?$l__Y^Jd9Ee&EG;41 zN*GcuL4MaFaH1T}e8xD7vs7T3rqF+OMhFuG_%U0;~S_RDLYS4&8;${4+ADCsJ1xQL;sqef4Ng9IjaD z3i?}1&+8aL+U@}-%fdK^zgiue^l>6dyI2v6eFp`JdFNqOOhVS^ISO8V#&Kq??1il4 zm2lZ2UgGt|F2^Z8DUVHDBs_bu9IcpM;xh5S@|EJA!+ck?N>M@WY85rfLKNrfjHHh0 z$EY~vUm*5EhP8s2;XLx*Tb*G1qi3=I%h+$>1;1;$5@onS#ZeRJd9z&2PbLU-dla(xcLveL4ilmH=;s%m3 za;n*T?BC&&yhEn45S5FSi0S;5s@1A!!m(5< zHlns@lxaXE{azp{hQ3X}`&>mm`1iy&V(_juTF+y3MPfUZf>tl0F%)I;o;IO)KwUKU z6fC;CXq;R;zS&d;yhw&Bj11*zQq%NaqODhphGnYTBkpT^UT@FuS3=L8cV8$x^D3_K`WRj|cS@tE@=>cq#+~uwo`)A=ifPP6CzuRqcIL z#9cDM%k$)cFXhQG%5mjlEh4EvJe#@2MIGnUAa=QJt*s?}1d5=j}x%)5>_NK^==0 zI1Sbt!gCqKL)x1*#4!#bRaPQ*Ld;~d!>)@yJ!9`A+P}c=OHKO-QwGhOOhhmc`YOQc zX=jCem;z8!ZQ>PEppE@U$ zbQB7~=em4H$ysHxz1XMtdO2sbA|9tLhuhcl zUPIeev{M{cbg7-y)YkyPEh5BC;PB_DLzoNw9S0lhumE0Ug&F~40PA{ymo%zuGVn>SXtC~Q2-T>KroJu_KF!8)f#5>ASOI{p3v$1AT>fZDXQP+u1W!39qRHd*G&G z!=Auv8U-|E(aqv*BOgRNwl^{2QDjOGaf9x}G-ndQ-;Z8C zKxW|+FfbfF%uZLb6gDuaszotE<&n07KS?)P!5iTQ(Y~~$o`Z0OHEN8M$|U1+9xBc< zA5guwo_Oy&W~>Rsu6hS6PZqW#IqfOr_zNwyjsxQW+c}pMr?_n zv7WsH-HCH%*lqBdKZNg!1I-hxRSWQ@XzDG-(+(->R)Js$8ufiJQ<2)fp-9OTf>;i9 zi*qzL#UI5@@*b3Vkl&=%y0!{_Sj{=lpA<)I1@H1^biAB4(rEH!l<8KkS-h)!x^f>I z(2>%aTlpsMS8*TtlYZmp%ZZ86|g@G z2_bD)3wzPfpDH$03nNc^H89IBU%{uMq4Kn)*Y)fVo}Gpa4Mvvq$M&C3wR$~p{}ldd z7Il_&(Xg|TqXXcIiuB9#xOK&0V6nhjtWEE%}d2EVMco7ZR`Q8(CJiRU)sH#RaZhAV&3YS7p zQu$|GZIp^MU+&u6#nAu-(d9x zh=fpWyK)CwK}8J|S(Q#y1XmumqMM4yh(qPSE^=|8xoVZAS>@%f@PEl1^Y|uAXda3X zY@l~#e{T}WZjF!pv>PY?96R$ZJc9n{i%8_VABt1%LRxk${VUF+Xwg!7pGURLY8PX& ze!VB0$g;YQG_J$_%C0Sd!uKGFH=sA)fQq}4Kdy+jRt!T`fwCqQEtXfL2&bNGB>i-d zQM{~&W}rO-z2m}Yo4ZzG8mODqnCl;M``p(wI4 z8s1xV8uG#vM^~idB+{VFB=d?B3lXU-%u;v=l6BCWFBwR1rcN7Ys8 zNjmcXHgiSKVbil~u-Rx|jcD-;)<(2J2EObqGA7-DvOX22uMo*9&RV5oMbn9nix*yF$vC*^Ge0sX2A8p?Xi|%D~{cS9~w&=7G z=(e`(u_=HpU(D4$&#*h_5^>p)>{)Ebp2I`zK?=d*Uk)s>+^-D3p5&m_Ddc97W6{eW zKmq4W5u&=Sk(&Wj4jx3;Pk>5-q4d&>ub8&H<2;~~=c;JrBK|5as)(W_iK2Y6EVr{3 zUZvA2cV_aI75^7~D<&yfBdbz!N7=GPE}bqyUo564anTC?uH~wzSyE#?Z(&4F;*m9| zT$W;)(uIn-@1~t1tfEud^okqL1HZDFJTFi+H{{Tne`#!(G$`*oG6C1g9YjKz0X$n{ zJGyNeIBEn9>S>+Ii^+pg+(;R}mGrFV(%W9_uoW^Pnt69_4W^;B%?VsY~fk8dq5x&1fy}1+-HxMtG7G(Mxf{#mr3>;R65X z;LFRvEFqG$iV^aWzneKLxjTzHzvjBQcQ&6h8B;Y5lDBJ_)gpQqj+XLQ72NV6CAs7U zD~`fWOR`;6kUr7agNoVBqE2Bs7W1dr?5Rk=s>BtpLc7|{q%4P5wHM6U(RX)B+?spw@r*H(fd=@!XhwVTCR;cq_I z6@QoYw2&URffMOzRSs`P?lVTq7^%s$!ecvP;3cbf+R1Ygw;(jIFyhAL&|E{;dXX#fjH&Wd(0R zEFCRdPMSmMB@BeH3*Um_{Qm*ZyI+s1r)D`$ld*h0tkz(-yUPg=Tp^l;mk-}O?sgkBJ*3V_Q zw*u8}>E<`+mDhskr!^Z2g2=JQu`Sio6P zs$|r+^q^MDX(#z1pF&Sbll&nU$chw&tD?c~bbRM8(1stv=O3UEC&8-`_&hvihLyMr zy|T|4OcuccZ43Xug|}0gdbyQ$3HFiJv}^NhgPr(LuM!vbp^wgERh(sq$zg2NlXwfu zS@S=z9x=T1#1(l~s<0HcmNL@?z&{(CbFu#&pk4sPUvexfW-j>BD$U|^5r37Vm_-ZW zPuwT`&gZogoG3n|-9^{XZFN}tKE%Hs!^Zm~HvAv)_s3IN7tO3nqUle#SeWnjF^_v? zgXz5n{CHV!4|9_78#yDnu^Jdue)976BEW{lr5%NH0Yol2TeEF0rm z6v}#u9z-|dXz8c#UHDa1wvaJB39M>fW!o3gw=674PgRX#lVD5LBd#%yiuiBP)_2Jc zTsB3}VMoEOst;oE#Y(%L%`u=;ly^V(9bk=Bwa^^DAro8YCFJ*e@Z8HlsY;n<$awaj zqU#im(~~ikN0r1wt=gcICm3Esy2K)3@!R6X8bvH^DRfe!7u5CRocjn z7G9&Jb_e3^(ti=SJBldBRNC&tdNI7iu{8pb`xc&gS&rIb%{dV&>=O_++3ToGm9_^0t zBS!*>UUVg2^d?z|4b-6&VmD<8q{>d{{&}c6-lg};*uQ%2t0GXIwp;>biVhStlQ%67 z+N)_;#F4ycS@)tyPfP59cGp3>-*De|T$7csfpwM~UBG)jYrGK3mP8lVi|6Gh%;Wny z`VhTKCM&A8j<=#p(iDOgjlJ?$l2xmLWFD`z^sjn8Nh_}x)zQil z$>UR6LAiA0_O)l3C)0qPX88Eo(8k-=31g752Ct|Tl?s>P;B{c^7SRqrXDTCq!?1B{ zl9@Thwb!8d1n{fpZRx2p?7<{gS^+xgO~mtMq{TYC`)fo|AK{(~(C$s*K#vkhsYDdL zCtmdP)EqxW?4%*1ok9Y=h-c7<{`91J)%B@PNifSF6sKz@qEdOKsvMCu?PUgJp%V{4 z?nmP{O+%*L~fJVo`&(T&8 zaaz?T$itF9En8L6LH5EzFe^JpSyOkXFzFT+c}qwJXQ2 z44=4CPazmZROWkfNKxeKrovBuq0%-J3|A*dp&I@HNGqNz23IIQp~#Okp=^}-%tadF zJ7{SOv?C2CJI3?IWt+%;ltnH&Q&d8FQFOk9dsom-Ina3=FW^pDNU9*+$(-*q_l9VV zZb+d20XGZK2p6e5v7m%VV%<-YTROz*bR-U!NZzA|9Yo}OEz!rR=0r%N`96)BX zD%fd3bbSCBm&RQ8!T;|fn}&eF^2m~#;9Gkplsyu5RPiT&QZWtfBA~(yx-7#;oxtcs zB>r#V7(I#b*YLpzWMf0Htmg>HgI8@n`!%U^Xh05Z407^!b<~gyn(P=!RBw0Q5nxk1P*o|~rzpF9B`YIONR^C= zgeV4k98d2NVC}{XKZmbFpof=;LSL~9@!W>m$Xug28eXxKbX`aU!&T zM#heZI-9}G>_0|t^E^OofB6MtnD1gd`|?Qgc(RE7kl@3)zZjO?$I$T*)+d;G7s2|H zo-7PKH-{&O5zY9D7MqFrT_j7hiM9G8=ftyJjq62AOrdKdo=MDX!#JBKFIq#IE>MQt0w$EZ-`YTU=6;__So5i%2$0SLj z=zy$VSy)~TqcXtSE2!wco}bKq4X~&uly+x@UxI7)K|$BhN#)VxMWLsC$d+Aj)IDMz z_c>dKwXBT%uTC2S9aKez1o5gw)TB95pg9#7!F;bn+tQp3LF<(V^F_dYzB}&;)U1So zp-}Ky9X@FD!^nGCsbM^y=Nxs0b&y=u?S|0OAvkLdyTe{2r~U^d+v8X;gBc|pYTAIN zd=;+I6SC^kS3@L4CUp8f8O#767=sp^h5fS?JLeO=HR7I4$d%#PcENbtek93G_W!8b2Yr zR2F=VHh)6aZ)SdL(7(^4pW2!#?phs!%D;qu{|qlZ4aQ^1?1my`6^qn99a*Kaz?2)5 zJkWeaFUlnA`DJ(EwyJPfJJ&KD50+;jf8xnU_hQ8wBNg<_JU!n|yS??q-Rp2;1*BL4 zV~v3$$7A_CN$w#T4X)?IJ_?uV8B~h*XqT%jN-uJ&$S!$(EFIO1)<$ae!ONHf-Q9=Q z8bcLn=&g=uml(1JHC>9Th>cMlE29E7#tkxcUog+d@ex9PunM$?`VcGR?YUGgKpI|= zF742~MXa$VR6oG2K6?>)sh#@^q4vYP?of+dopF01fv2+v~(ThwDgR(J6-xunU^KN@;%VWw^bDR zl(303tnTteC%n2OBt!z()AMQDG6EI$c=W3OR$N%o1jXmPT7UUDve#D8uY6$HukyL& z)5?;b!&r)AuYnqs?@@+YJuIV*EDPDmidZQwyN(gIKmj}h5O}JC?xMx z2_!p6`HJJ5na9z5Ad@A(oNsf1U!J}8ZAe=QYA=p6hfjG8o_DSY!(8US609hS!GhilXI{Xg`N`=gStY%s8Qp7VBz#`E#YA^75)-0XsZ>2nZe81)>q- z$e5*}@qU9(`7QYV6z%gjY`h#iOFh%C0d&`Z-s-{4W6@G?TZ`e4FkUYbulX3QI|E*6 zWJ;i8zUTTdcr}z&xXYT#lT$oP-j(p~Rq^P_6Pk;1qh3vjYWnmGPxsJ|6_C>%8Tm1& z`a`7c3i{oMHaJE7@jaeF7>s6Zi+<~j_1DtPpRIP|5_&31jQnS)whUUnJbc*%$uS(s zkd0mUEOUGc388&?&9OO4Av@UT10DisTMU?+A=M{PE%`ce zO+5yfo?^6-K-iY3ei$@URTi*zGqQ>$!9+N?9O&}+)98?Qz{7g%jg#oXLcmiOdC?7c z+EKqW4oi42fBTwHGBd4Nj~cwn5WhK$B{v(HJf3m1!>Jx{6k_h0zn+)f0=y+N?f+cN3>68>G0^oe{KJp2(~cVld+Q>2I}4=q zu#zXUlBx}r)o~g=+7HKg`(tF2%bQjdRFPIMm#P@1V#4|>ZMF!@V+n6bFI6Ud;c}-u z6+WRzR`@Fuuih*hzV?Cl|HO%CJBY(+AC>qd8e6h(7RS;CUR*==yw*T+Q1-rdcrM;Wxzr!;O~Q; ziga~dBX~s50@rg!^rT5u_3v=+m;IyIiJn%WD2nnl%Ul~t_RehJo#)csXGC}w@J*Uw z4c5|nqLx}6FY=-)jnB9yk9j`X82Q%9#?J;y**=~xoFUXP z=#UObi)`%HXBhh|uakHrrO;Z%faVlZ;zO>DMCUd^8{c6z+T*MUly=1I2LjQMs(S>F zJObsDB{y_dJ501MMRn8r&?kDPnD}8hYxNqoKO>rv-x#Ri~W*!?MN%r|>X`8R|$c;XqnTl|8e7P&}#}gYq-d zKnuXir$Dc^YnZw6d*XrF{8c7r4Lm5Rp;>;*K$Fp5=G zL8|wM>R!Mfn1c-6!VJzMOY)e*``Bwkp#R2LKNawK^o$1Gt$hxPVQY01sg`f9HIgh` zj@+Bi@%P~OdybTC@~U*?H_Eb=##CfR{Glh6NFpuayEsOfdU>bPm;7Q1IxheY2?dXR zpvI?Nd*WHFj!&>Ezaa*-me*F~;8(of#p}<8i{e?W819j!5l93>&kj$7hx@`I)8Mgj zMDsIQJLQ{NVjtCFl{-McN!Tk-z|~)&PtIa<7`(CjSYG>yz0I@U;JyLeQ4bqbdPvVi z(sM|(8|oO`!*4T!O+BHzIP_DC@%5__rSZ)o;0gDa1(=DXP6(Eoa!;?oKg+Oc?&JSf z#}+Keem%ojbD7&ytVwfd&q3x}jG$^2*)XDg&%RNXU>0jHoA=uvsOLK@8qW@y30Ac~ zT)9H!1%+Kj$%I?!QN>>M`=R`nDEhQ8@e7{ns#WGM6>o05Ockekl8$N_JP%DVMD4Pa zgwb!p7H4+#(V21hN2&NCgRlYy;TyCB<9L;BuF_U;RDSS(8Y@<%P!x*4?G65F&T@-2jwp)L;3J?wQPy3VIB}!w#98#I+*=+a z2}Vh$6=-kiQh9NTX35H#3AC%+>z@O;?wLnB#kIr_(*5G&IUFzJrJao4lfe!Eqn=A# z5!ePor=y_L@#sETxs#!kk-P>&cjdA7^)!1uRZdwRWpTaAZ0SZl0fel$yN5@=8Ep;}?>v{$xQ zwIPzu%4yG{PstBYwtYvB-(fp_3uaa8Ck#pk&f>4~!io|ugdT*~1zguUsA^#)cX<^O zvT;-gqAcxV=CI18FL}ROnc3Vk%U!#xmn>rY~1sp5G(GUqUPj@{_3CFB8~hKp4t9>faq>}A)Alm)382|c$+ z{2>m|^Ro05LOqpGzx|_Uy_aIvm7zIBB=oyM5$I6*0TacbA)Y=4+@d5&G({ssb$W)O zYWwsI>h|21fKGh|>i-Z+Q2SF#VS9vNft2T|g~jm!PZKSD7q5E?e9;y>t13~y0;*l( zio$vIJc=HvE<;*oDLP5ktjD2>Q;9xR&&RWUk|M>c)Rj`E%z zsMwOIPn;vZUg6T7q{(XY^Yy!Qi|( ztJ@7J+}ia5qzCJ>=2f86i%_EK6jk@8$~e!OS^;(M27d9F_B~3YNRKFf`;Gr2msjR; zG?(_@a7FcF3$a|jg??A^DGNY$nry5koc)fM+Q~kd$&e46#rbD_(!itGYGH!A0--+pj^2>~iU0j=w|GL>yt zRM*>;sb4r3*Hq%&6?hWy1*Tw$JOezcIA6rb??Lfz5UY6(`(`kfN=Nvl602`P!585u zJp)1&B&q;Xg_NnSv}v4->*S}+=o{A)e>me%UCPB zdf%p=Jac8fymt|{0&E+ zH*|ToB4_oxPt}l}Ww2+eB7thaF^zeJB1vn&Uy+nROc(3$=OA;0hiO=zc_Cn@#30zCm; z9DEt*<)M{i2KRx|0vaE(O22@uijAYpMzJu(cx7j3XS=fY^8S@G)9xcQJ+sj769h0H zdIBGhB7K9Iac$RTs0{@-MLu;wPfWpTevWx)MxVhQ`BX<=!biAd-NGBbM3j6tvDD4* z$Z|eE$7^^7>K#sX!vJR55}UaNGDyEpQI#?D+iv0Tg?4rofrd*XyRRT)^;@yBPS-;T zsu}o(wU;ONIn<{J!(5IPeG^}=;%GLqL3Ak#OTL~gFiCkuT%@1oa87lXvIAE#W9{zc z7k=Q&GH_-vF!g6O2CxpfL>XVfr+6K2M{6S6T)$8ig;9-SZo&wE9}cPjXnR9z1tL4rq<;8 zm7JA*U*-u~WwdCjUB1hBdcpL7E#pkuzuC@}_WB9E;sV6&ierB95uQ>JETVU6!1H3B zU73BU!{2tRQJbe15NE?oSM7R6y)ah5JT;xhyh`E2-GXG-j(7H%v-gHPhi;qDMx$H& zO@B-vR1a+Hh;)#8FRq8q>6?BoSfT#_pMD3MR$^Z;n`j1F|>3y=Z^LF-4bF1u)61q7aihTM;2^9=T{S$r}Rs&O(r=XidGg0VySYaq1$EO1VJ z^)jxR4%N91yuB1_gZS8+GkXksVXb^B^oJd=dyQS6{$gJXz^<;G>|u;Gfjeh|{rWKO zW)@3pqE(iA|K&zJ6PBq-sf0L?-2Le zA;7GBHMFCg$gSL=AIl7m9pTDd*4}{%+VSBCD^okSHnDh0h_*_v{9;W`MaP>g`It!YlM~32^e{h{c|YrCjBj zgpBJJ%Ho%P2{U%nJx`;S>~dhAC-=+zer**Y%Z)4TLt#BG_r~#-@C0Y!`SK)KasFFA zu_Dz1{+yd&zqE&n^@QzQW5uyGjOZNpas{3OsJ@VORj&OgdmtSVGo`EcUX&Y@3wPMX zp&X-2y z=h??;9p5eupNa26Pn-E6{&ywD=A(cIi%9msTn-*FM6? z>eHSPp=*4_Ft{+NtvMLt&46f;ev<7rl0JOnHkCbkF>;&x&+kSV?PB z-srm1x^$`iDCCc_60ed2IF53%yvxcuzW;-hBc#{yO!Zn2!5d3hMoY)Gk-`5r!1T5fiSy+qX7r8L%Jw_1wTzU(R>?3J#i%t{p2 zB=$NfrF_HQ5K0x^V|7^iP3VClW}lehDkbwK1N zUhP~`JDYoFmmTS|bjZKOgWde^Dx@)H=vp&KABfU{b{MVbvuk($u3OlN^FQ)^S}{_dY(9YX zz^npmUbZyGNbnUwJ29$HNkpz-R+72KR)(|QpmmRYrmHgd$6W89`O8Wb+9kl%)z})NVqA&V9KB6x4f!>E{wsHzH@FyTlJ@k|0^&$!1Bp#`Lr8UHY4&PaJ3?9dSdLM;K_1z)|1kQ=`(zi9!)unSoss*327troYf{q zw&F_K70x+X*J=f0SliDU1uGcI$}yf1Yff4{Dy>Upy+G-V6(qFHo5N#1zLiFWxN(){ zhkVB>tWEblpPN7SO@OeOpyHzbBrA&=`Q!Y4<2laWoCd2ir&Y7WAL9zeoCT~r?eC(k zK}o`@isp#PmCT88UyY`6zGB?xJlD!*_M>n{c3rR%m-ShUN3g1~UIwcbq}BGcq5G{E znfgb*=N_Y*?QODxwWQT>zTx?L6;jW%&$Et*SsE#%JqgB%TP<0inciidoHcRs%~KS40$XXDx5;;QI4u!q*PCL8T2Le1hrRww6I!-MhRDm z(Taa^qW!%7;7YY$go}kNeLgwQrGL|nRPwN@-1UNRHo=i`#=ZGdQ#cF*&_m9WN(vRITzN!r?(xO|8Rjd~K zWR!qe<+*%P1q*Bo;Fji#?IaiEKDvAkjc3x2aW4H#1~TsZ>_}B$e;-)T6AQN;+wpZU zLPhS!$G}J>0YmdSr`8c7hm07>BLN38oJh_R*U}dpEGHI&6JR_>HRhA>yHS``Z7k0N zu-9FMMRYfnJ?^6JNjWm%M$$E;4p}7+fF*VCQ@w=U`f{v#dJ#r~gLFz`zsrMhP1vJi z_OCtTv}4r1%(g!JS3-TJL*PP+1D>Ond|HibvzU2R)?u9%?ZWK>gc=46ZV%*60jFM~ z{#_waVfT?WwS%56OR3xWSk#&m@+H3ITiK@p?EC;c0XGoWcZm4m%c*Hy_4(My4HV9Cv5YCNWZui&z#6@6IS9}^BfJr?trYfJ*;aj0w8Qf~l zXqEWCA1C!4GN{fb7wE>MfLgpCB^#30l5z3=xIfh{dgFh;3tMo1?k;9+Sv=imNY^T} z3&o6G2sBOs_ut1Welq-`YyRW(>?Q6c7x3R%$#HgeJ&H4% ziuclGrXPFoLG(JfT*Bu+Cgqas_%L1PPU3W&!5%!%c^JYBgtz%5W0~E5$?Up}eH=k` z%E569uACjUBmVAD=)1Y=by;m0Gu9e^JXD}N^SAS|)h&zJwT9qa4MDO^Sh8STk+GC&zk~e-`ioj59gyNuc7cDJp*I#3W%}CMgL+& z7sfZm*MU`C=u2>AR0AL24R{``HPxN@7)#ZP+2%4kVcI3EvlaW^E?`x2M!bQl!sW@N z{3lf*#!w~gthgf?`{zZ?plY{*jeWwM^}($?IDAE{bqN$v56w|z7d>H8O(PjffyI?s zuabv%7PMp~6|MJ0tKbroqn5z=DEXZ2sYd%IeT=&DQyi@!hqXIVd~@-!4r6YPAV=$f zFQpH^2ebd}!P+{Uw>&%mX$}iEC!T5yUkfnkA@YSUifhHMCBu{Xne0pzdR>*qx3YpB zjBKBlF6>7w=ma^(_;vLB-gmGEb*O~Ul_=Be;H+h=!`xGS;O2PuVE_6+-;KJd$6gl@ zO@iNtC#+#)t(f`%Goii*RVBd`qZ68N7Fuv^6`#xet0IBXNsaH3`k248kE|BfMIUyg zh6757Py(w%(D7T!7{=bhcroAa;#q1tS_M+;n3giRoAz;QXd!bVuWFOgLcLe}5|p?m zICLs>@F%iRE{!%&@wu2jR2!jee|K6Pey znlXzkM%4@64QlWLRk{8iEsw{>55!N#H*+4|jZP-=^f}@LT7v2Bt9g?8<(q+_eHo=a zd)%5C6!27PH*+GYae7O`Id9HgrL3?r&?Ng1e_A%!mjk?a^DYOPPzUI~3hlZDxIP>o zNRCT}K%*Xk>&}i^5wkD`h|wn}d>U9|2>Ia;lDk59VPd0iVz|fIHFm+y{0MNuxbltFzW6?WYI0 zDTsRpZQ;$^*+vpzB2u&_W#|_s+G_^gBj+T1--Cy4$>L_molo|pg#KpbZtL9+E0Fa7Bcu*JgpQ+HD$%kfLCqSZf2Vhti}5x=39>$D)(1q)LLBE z0s8o0)*8CA7sh`iuVtFj%Wh_-aq=eJ)#!CVrqZ3@mC=t)I9DN-0H`1Egt1#v2cvZ& zc0)g?v`$S}O&5Ka-NoYzMf!h>zIJJ=v1QTUj5xd?d%5naV0sqwDP)h0lq!Pq83*Gz z&SLe)BR$ylabNrpXsPql-qJ_8MV27Fph@3m)=kCP{m|E7>BUPi>j4EU%VQw=PanGS>=jfQrN zf`Sd?n?gpZ!tZiCsXpga9dj78u3I>pwZICgnRN&%@*WxvZWt*=t}QP=t-){e7nSuI zGgD(d-ofHoQRCw6|8E+*`liic<5+WJ?RaMhj1Et^PSP5_BZD&%9S|JYWeu*z>Xt) zn_=DNSSs1K02*arU@3Q$@Tv#)7x08Cj9{_2T849=$BcDqGt#lRyDhRDHU?#yR~#=_JGy2_b!F_kLueGV8Dtj?^T z_ym4$Oh*kl1^6M@CpakFlTMtR5AFP9-hz4h8SMh6ZAHJ8_Go>Ac49QL!%^`eF^-wn zM%!gGj-CzapRxMX%;hW+Ndb4*2E4T;?PRX~k<8adGwDJ3Xc9roy2ii7=+)6^qPp%U zLZ^AaMtL1nmAxqdVvX31+N`i3(9k@_mLnPGXFSkwusjbwI4e0ZQ;>N%^L^&*WL45I zo=BH~dSq=(WoL}a%L6iX+3O+Tx-qNA@nZy<(P%N4(2!>ofluw&m3G`AJPVn*9%=1S z(g@F^c_PFc@r^q}yrJ?0d)$ru_Rp}1yoMF$$@o9<*GRDiR3WQMEa&-ftvcXn4y!YU zE(5PI@g8QFIbGuMN;lS z$HKowMdY{L0yN}J4Y^O=SCxC^GS=7hgpA61h`8qe((imqreWr#>~fj;nPzb1lj(3) zfFv}5(^HQ-#Gt)$Ge$Waq$~XK%(4pSCWoKujHbP&9UwOoUvI-cZoGlmvJ9Ca z^~c(0UQed6L(;@G;FUU)cIsu^1s-$d0lxM7z5MoiZQ47SA@N1fiG7>{t=Yy9?Ba8u zVHSe)91kvghAoqK#^4%3VlPW0O^_qONby8|ZjO6*sF!vUvpq5aYaLgg(JIE$W0%H& z={43jm3n6NO6nofv#l>%3%K;<^zU?jcO z`+&?A;Gn-rf9+akqSy0KIJM@P(G`K`>|=#i?7k@LLn>!ogWb9VJr&y0|KO>p8#%;t zvG?`i>{JZ$|28Qs^D_qU51z4_S?J|Aro%`d^9%I$8)qe!+bbYEi!}&;gb)o0W;epx^f^}P7qFh)0nd3hz96m+ z4{Ahyr_x6gv777dRqH=u_?dxx+>8-z@^}mQE{AW*Gn?Ar_%Y0;3p7}*IiERbP0^3$ z&h7>`js36!kDSza9i!%myyXgOsu~F)=Msj-C)qL5&WgtM8kt~RrjfSFRazH}@emV~ zd-n1ch-CPnVhZL;%qEduh6k$emo;u zLY>Ym`0Z45g?6l{3g<)1Uc_oUa@vZJ{<r(W$%KOTa&)YprjEN z+q~#1?1=Xw0hDo#c~(;P)N&z5CaM~q#U8N=ssgbW)DZ?goLtBH8d=Z6V59fd(9LAo(Ca;1yYioU%6=ncSL;PAbNKLmEGqx;TxZv+-{n zAHScpOwLK#qikFk9pF^uL9b?jrD~1Z==J3y69WOGpZ4&aCA^a_rjo6({v~kalQ@5y zv9s;O_H+O{(C>8IDr6tah{m4)O{yOx$CL&bJ#A#4)Iu6BW*F^ukiYTG@|pGmjxp#bhLuc_>O6b)f;s<2+IQwGvODpS#fGW#prAkyK>h z$EaO>&(;|^%yne31M!1A_WiVyy66Fr0s=K3h z)YE#23?Mr0aoUt+jd?QmNv@#PSFBZ+Gup_NQxkN|b@+K2${*LHiYz>}q|#AgC=bBAWo z_j6dB#CIh9=nDN!@=gb7afdm8ud@W|a1!&0@_Z*d$(|hSy{~rL*F-Nj_eo zXX2sMl)o98+=9wRcT(l@l6YrQmrlN$!Tf}-_0_4qa|v^`2Y6ASK*R)sjYcCY5m{5i zeN5#=DUwuC9s3B>Q(R4ZN(v)+K5zoxY5{j;_PSw~#>jh}+`|YFWj13i(|Dzg#D#p# zGtAL6KE=2%BkGiXU56Mr*=Z;GQ78!$zh(|22E=s7`g}UITK6c*VvTj5Pwn`-}!S`;#a{m zM$iLvcib6&SvEBvCq>y=pTcp+u<9m(W-1}4ku}ET81JhjK>ur=XY8Rkh0FPIc(iDgjCW~^O50hP0ulXl7+FzO_7qjnNsvpOCZuTEMg zJ(KS73i>>K6!pLtHv>CbU7ngC3uwJED#?uYYQVECI7deeaI+S0rQ#4XJIMHzpu%&g zxOP#rC!UKR`D#22ldz%OODx4TRGe)Im3kTNerCKQsY_?$uY+x6A~i|o5(U#Gs~&J% z2X&H<%9n+WoL>ppzm1^Xhwf)&sv4j%a6fUi8nh=fm6eQsG)_}Gqo%9WEl1bK=T5B! z0*Bb?a;z(dIp?$Q`gfEpbAgSqOGB_!EuwDS&++j1V=USS;!p4@)uMu59#J=c$A;b= z3{->T6fj14#w!NWZNRwBoP?@CN?xsH*sOK{!1_+gdJwDHym(SFIWs!5KD%#rm(0hR z=E?c-LqvGwlfYqfq9E&4{xWI;vjZP|$5#w%zy)AwZ7r?!(O%s|_(zLp?q|L??j zcBSKbXw7?3l3U4-GBh5HfDhQh*gZXn#o$#1t~dl7cQI$ZuWEAE2h0wmnE7OUzw#2& zAmbebUPt-cQz>OI>IUmVfM|6_)#7HJ!~sT?(<#6I!DwrsP@HYB#+jtKzIqi(ScSB# zGi&FJhSSJtc2+=7IGDRxn^WOj%)c^*kl4YnM&lE$>!>C9Ao~x6W)4>FD};Xb3*$HA zH&IbM6+1HfVO__z_*p+@pFhX*wIb=2oSR%lN503X$$e+kj9ll*Ap)+LvG4)&(tf?3 z`QWJpR!Ti)n*_;@eb#DMz+M?IQ-%5Z;_LtcdC6*^W>$$AQATH{IcjE$8JlDVx019m zQcb}k_nN1&FY==uK&259@l|+)x)70ZVZ1(RL3ibr*uu_*)1QYI<9V#MM(2Qa%xEXi z#%s#_us^yN%A$;Qm=Sk}y_93C;b~`558lNSv-w8Ly59Hk(7Dag&}a_b!P*li)`+Nt z2cik&vAz~OJ8c7QR*(wv1gh+KdKkssI|@$O=TnP7ImT3Ht-uM)VdRe7{UP-je~#}= znk8Rm24pVD6es^qTA)+?5p|%B>y7Azdg}0#vj5sol7JR0~!uar1S~t5R&1YD_Cuw$=wU3N@-HN1Qwuthq+;9i0 z@H{Cw8I>-NmFA}r>P9~+#j7QxvCYbr%CX|fMsQZ_bl1)5Py+FE?&Nd7-yI;Ov@5l) zAF#n#1bs@bMs2~!^xe!%d&VAc%6L|+id<#vWhZpa>*1z*h)BALn#0?uto$4n;!@;nHYtBdh8ih3&8?m&Dxvm1jXaJ0vglCH#=9?;EE@ao0 z+*k08ymlEg+seGmHZT@j`)%s?JZk(`|Su_KFw0Fx<1~2R^Y%^A`G9JK4kB|WdEbBx4tVg<>nymfM6&}Y6 zqApR$J@4UB`WbEGOzb<`=v6S4sMebJNuG#$!2ceH4h@FZ7}cpnmHv3P8^ZzhJGNns zC7jh=!RDAs(#Fsj51|EQ6RXq?7INEIk-nn};7?QTl-Ct8JFTfz!6&o%^ZEQdtOC1( z#o*+4T~du$kC?dH@kB>HiZx+4)u0#AY4&EkC0R+;cyavqxG`&L3|F=9?f^~+^cbis zSt=zf32XKJiQnddXhqVNVs4eW7g}G8Y&SzuJ>^$sZ`6+!gbsqs+CJnj)&jAz&F}1s zHXF~sd8%94Q!SaU*Lp&F;=GqQByia{r8s!4)c8{ixK?nj4u_#8+W(Y!)HU?O+Sy4z zVl7~#_eI{FQgt*=J~xU{Z-m}I>-9>Be4>~mpIirSR%Lu4PJ}%7Ze|3zVN1^NEA%cZ zp(n{F#3ua_{YKo*$f%S!;J3@<8%3L-I*C%U84?Tl)JkM#j3|F=v)1mnfNSmiYi|g3LG9Xhl3v7E{%Gfw z>X?h8^-zz)dRC_Hi_MJGn6aZ#)3MU>Tmu%wRE73z2rFYN z(VF{aPKKIksHMaIN(}mhjBaa&hh`d4F-6h6(XUvq$Hk|_&B%%PlzzD-RD4-MACd;t zhrXW}=;hQmslr{5bypXx^P=M@ZN)8VKlr^Ppg$)>4MH$ zrGLhAT!qzXZ**N8VJ{t>%q0Th+vFzVdcKC%ZzL{y2$rcCXcrN_fP0{Wr$Ya}!m8JW z+LsT(9mm4uTk})Q$YzyjHR#9*|B(8ppTwsmxyi!J8AKfamU%DJJ$W(SK)y&hATozu zRQSn>1Q-^Nj@tmY+0k)8=L0;=mtZq*8@NmBz|rOQ_0Z^_$l65S#=-dcO_?_c~U4l6r#u+E)s} zb}2WV>DfK=rLCT!G$!oP6PcyBukLAfwA8{FUhP3kz+i3n`VhrfX{}aJ{i~_}B9%y? z{NM(Z9oQFxH3dAk4XZSEi)aUCqs;Dlvw>gbtQKne;8`WsVI)xvBy1%%J@e+P7~zl3 z$~ugNz?#UY&4I&xbQ-#lE*(?jWyu-I{mHAzwO9imjw9e!1|Hmn4%&%pi=i53b!bV} zb5jot6C+x}S(H1}9S#Q?Bp=zyJhT#eg3XWC%d4$c?~ImRxq2gYa*Gkonqzu2BE6g+$!s`5H^(r%@)YVV)N=h}A5S7Kg z=L+-S((YBt_x9yAhunNzV=#@*H8*suk}>z?5EloXALVHW0r8A z(Z6Y2n>j9a5Hw0inCn*q?=GbMl zO6=v%%A92C$Z)Rp%4sz>zr;#Bf3Y9ZA#J-#kVesDyz`n!f)W4enM}${hcA*NVCzq3x$14h}8-fSvd1?-} zg=4HIPpBW7MAK*m{Poi4RB`}LMs9x)j+}|h;=H&9deXz>Pi3$^-UN5(1sAkty;Qh7 z|2G6?b%3)m;YIAZu+wUh7v`bYEd!Qk^S7FV^gA1<>o!YS`qE`06zAf(OY=>FT}G}k4(H)@g^cG>R}@)MN6`G^ofk2 z&YLh-E2mlu>kMSBZRjiiq6^=f#9LRz7yD;?E78{Pp;whd+MR~Qzb#mz#IOBUE2nuA zR@%_MrS5=7l2Pk$@<-y^eK6}&dOBSYT?LlUMZ38Yov)ZKZ{^W^?V~mV$z>i{Hy;7x z>!ML$=K`!X*8@$vW)Nx29_8>fV=%PfS-DWHM80R#VTHhf^tskyXZxUYy@GyNo7n5y z(662(3uRQ)l8U8YP+9I`PKS~I#Za^YUhrQaX1B~sk+lk=caRniB{MShGCea_WjbOx zxGmlhpHGBBFKX@Gj^xk*sA-8X|H`hh_L z$H*x4I4iTt@jPMH71AQ*-WqT6n~-OYRAfPJG5f;U4s|_avdV+m<}9`Z#zT;pKEuy< zE&ji0Q2r+9zh~i-SQlSUbmm9c*Uw;wt{`V{9&>$~6L%>#wz_yr8viN)K^$X*T@V(Atfm|8Yri$lP zjN24UL7HN9#(Wu5>uDw8lE1Lr@GgfZDbGp&eSz zq94gR3qA`UAG0&w&v)6-nNl$S8cxnZ{1vz2$NCM+$5Qmzo1^|==kG&HHE&q?OP#|! zAS*nX|D#_`8Yw*|T7|i3X)Z&Hz8vp-0h0cUM0A#t<=YX8w}ms+JBpB{r*ppbC`W-i z$qS8AAsP^F!fH7q_K?v6Cf?S7Zy94e6FmGK8|_o{W4kQ=H-3tJ@e(pOS~Kz(d=>LJ zi+wqz^%%D%@T&lP{sQ-7_QL&=^O&2qo0VAEP}*)>oPI$$$$G9=)3(a7zHFnXwm?g@ ziS0#}(-I&pQ6^LS4K#%PugWR&32Kt|tLTFE`DWnFf5x5SrAZ0dW_Kl*Ctcz#NT*pq zp%c>S6-Zm%fUH(?Z9-{=W=+;>?ncPmy3!Q4Ml>TfnV4Lt!r?V&b24-@O43 zSsfzBKg3fx65E}5q>UL#AEH*zrbN`g5++j*>@)s<5lrh)t)8de>ZgZO0tnZL1%h_%⩔ zW&9gDV6RD|q4U|D!%z`vj`FTG)2$|C^qv$Z)l{ryqdaCTnN&(iTN{Jd$f@hIhV$So z|D{*hBq-cYx<$4}&N~8CnZ`N)8CpLHNzj~2G%T=QjIIOavxmVgSY5Z%`Kc7neGb&J zQB;I(xQzJf7^`9r_|#ME?tFOC^)YyOB|Imm zA#uz=?l=aXmQ7657V__EF!O2jUww}}i%oE+SAv&s9s1@JA}q~wGh?6%XT)rs5-90u zSQNhmOD-oqz7O{0KZsw-C1YwXS)d)F?bzNQWyfA43cgCTmx!9R#EQv38&Y@qpX9=w z05_(8Fz4GCMq|K~&xopIB}ysE!djWMqF6sf$|W7s+q;6_+EB%C?NezL8zsIaT&cw{ z^?MQ#37#RRiC5gAwNNhPiSSM<*C-EKFL+779%~t{0jJAD1(oe8F~1#1b5=F99*mW5 zeuZPHb!nfH+9|1HMT7RXMN*yxy;+E^Gz3fHrR?|R{C^s-u7EZCUMw3!kc_gyK_%66 z6xXPw{XhJ_8adOr5v@mJwA~M_>6X^Y(HdsNu@N3x$<#8<1JSmucSZk;S12Rc`DPvO zy;d9SM)X6!5jNJl5oTKA7VwD?BI=rIs%o6pzP6XR^0#rqYH&VD>ZV0l8W&_UF!M0D zs~yhRaI`w+LB&RBtdSM^Yvyyu3g%!$qP2}&$y%PT*GO9`5oJMQE)Pa)*Ov?Z$W>|m zFLPn6aU*|pZbo}s^Tmoe!d}~@&oOG$+KbPLyslSqIrYZAfR=p!{cAHYCV*(5;0=U$?Ztc zhjQuElgHU<&dIr&6Z1B7;}SSdYr6OR2mhVDbMRsVH}!2R`YCm5NyQ7#6DkD_q9U{0 z2E2@pQs)#_diji`5DMC)sQ<2phh*I zl)JNbQ3Itl7_!?Zvy+(}Vt$+_WVzjeLTa_MYv3R_|7Y0O zYeIi|0kIyyFk;M2)G}F4uar`JE~k(MJcgX$kK^aA(9N#Gai<{>8h{S0iAH7}uH{U5H}1 zhP#%q&H-@Jhw&Ocg#}?8d~_u%yNprIB;g;k6jPNiT!oZK+xQQ>lZzW=q^xrioc9qp z;zH`Jv_Kc@Nl!t#fZ|Vk71)kNiYP!8@&Q(hA5^BOUk|$=L$gdmQrMi&QJ9fLG>Z zaCQP3-&y4RbRomKC@P1x*OIy^WAUO)182rY+G7`!BXcgi$=nllaq~ln>H^AI?6gE= zgX>i}dB%>Ueq(#DjX*PHLO5mC%Zedej#_^7CN2xq#DllBs-}?9MJ0c+W1&}p<`LW7u01w zg)#Lr)CyGG`np-K*s~#y4 z=dhz#F`*7sph-p&SZhZ=JoyUTQ^?%gGq-WXEd2{8T!eohAK$=h@nUi#bC6k0J zGu{VCV&`y8XRtOKu4`3hti-@U2~S^4b@?+pW$t5hr03CA(_r6QbKV}Il1~e$)kX1X zXdZ>p1|k<;1$S;kLi-2~_%nL_kDSN}$SFDa=kJC-9f!tUH9SokrGBHwH{!jyJsIY& z<|%Dar%xk91Xdl?KCK^mJ|ozx z+zNaf10~l^p3)pWU8y`wMGej$k}=qBj;>LT)^WLxQ<4QAc|7_J?tXE61NN#ZLUUln0@SS4 zo7Q61kGqm{X_sv)zitG(%|0ClPTU9G+Jg4H7r#&$+DjHSqn3j$Gmtd(l2_(A=BX)P zC?6^trBcLVDEH4i^H+YH^Uu8I^GvgTtT`y>(2Jnu#(rT3xMDw_>NT*|Lq76ucj(vU zSbrBFE#yF{8-YK6B3sOXUQTCzZP6CAwQ0pOBKp^`r`EO9UggQwMs9SR)(K@n^IFV` zBEFZ|Y7;j~S$l%kiOoS`lv5sHhSnCfPOd$Zl>78-JO3^G_8w`Ab`3rLR{S-OP+GG+ zoD;DaX$)B)SU~C!0+IcSr4Q$tGyOU{u`jY7kMxr-Ecot;7uSd z7jDCO*SCl@OPNAQF|NG<=sU`KjL0%(Pz!8o)gvY_NJ_cP1s@mt+8TT7`9N?!Rd2eX zLp%((_!IqUFDLbSq@uT#8iVT5E&9ecVhk(J@DvFmz4#TV;Bo273| zo%*SKN$gm}XIj!+zcgNb$~*u)-~QA0WsMIle`-x??dG}|Z!avgNN965c3GXu5x{7u zk$&<#WTMmA=ULReT7+bic9*Vz#=aNH@-4X8r9i_-A^bs%DEHL%mijyFr0sbyZ`G5P zW)gKUkSL;422=uFD7uErQk_sK__l`FneSwU#*jM8+X& zy;g(Mx?vWqFt?_zI_+|1Njz+TtQn?STdQ!Qn=+?kz?IQRRr81hD`fxg#_F&Ko_>V5 z<=x0j55NtJvQ`mmJpKStcG(IbnGdhy%|47JG7Mc z(dl5;STO4(q{Y_cGL#WJ&;-8UDr!Rn>Q-?1c{I%nfR6RMlo5+rt1_c~hO&94Ha+9T z%nMEPfP+PkwVN4it?-q=$6Twl3cnSX^)4Hinc|qVFnHvF96imzU_A(h;P;8}{r6aX zOC*Rlv6DBYs^RU}SQ>zfEYJ|Nqlby<(n-w}5VxJnr z>gQrzZHc$$M@uMWXK@F)^b1L}r7h&0p{DaH;cnSh53(`bdiJI(hC}CPVTzVmX zEAJS&V_cVTvhu1@kYj2=x7MyuvTm=smvMA*aPz>Gmk$7IYArCvUp!ZN%#qE~@eC6) z%M;DHPx+X36339w({qbEj1#x&><;dyf(54_m3@pd&<14gmb&N~;B8OB@0gL*hLvly zv1pAm8dFMUjd8EEg0L{BPXaKg3GTOs4opH9o(r8=f(BCs-7O!T;SkXO0(;CfC`E71 zny0}vXyN%4ocR{5;V1Ul4q?_jwpO)q6RUV{Wpg7ISM#mf%0jedYbK{1lHE6JuB%6x z=cSc7*!jT(&-gCRmC}eBs__<{_~krZey0Ym)lI9$V&11+ahLK8W4x^Qt3;*@uZ>dc zf|1u|?NR%R9jO8isSB2Ht_HxVu7DD4!Uk|6C*@(`6)bZEQCkp^&#=(|8?yw-PjMd^8oi)fBAkqoHFJI2UgsGhEJjQQO5X&3wcy zE7mBr$P<)W^w=4-as(QrU!Q0Mo@->f`kItW32zOnNb~=+&2lopP`Ds)BC1V30L`%) z#~^f$ThUdw6W1{q3-wdPOWsF@)UD|JBcePcl#j6oO-Fj~%L=R;m=o^z#Omqa%ji+@g79utYkQ>^Q0|KPK!ukkMW@O%9|A!YPKrWnh+%Gg}yv#+;cX|Voo11P2y=!Afo4Qbs9^&2TTs|8Lw zf(&46lRge3eFC3hFSYAgXI@#~I3fGFsSoT3v`meO%mx1G|Iw179P@WL%;)$4)&=MeOfN?%jplD%U=Q4YL3^ zG{hdU8&Bz{oYZMZO2?`@gdJ8wk^X4;*4AbPcXb|hg4Mk2n`*W0Wx!tRw7R~1r93V6 zBsQbb7zO!C2WB^!oxX#8cn*u;%h+q)hrd3=-?uPV`?BHn;99AHxm{Weegpf|R*(oQ51i6Y8tN3<45VVqfb=2W+4n^cfSKt^7hY|DCi#oC@E7t7y{?P7 z(>m+=(WR1K@+@O##aylacI5VRYsOo_d}Vmf0lqb|)#wGI_z$vsfvN-v*uCBcc4YWo zI2^=6qSmjS)Kjfh*H|ujmHq^&yjp0QS!37Ue14j77Kb9s-w1F21Iy`faUS}E6{^V`2kOe6M$Z`YZJhvXife^7{@a>-T40R2)z;&RTtVtj zv9!0pqoYH2n0Gc7+PPwW$WYsaf#@3{2fCe|7)B6DD}bfDAcU@NuWxRv3wQs5H+cIJ#2f2jw>{wPM#m|3oc%n-S<%x-OkW_?FGc?-j}@^1N>PbdJ?!Dl(A26&)u5Mapd9~1 zTbsd}yF$;6My%hNj*|eeDG~>uew+s``R8p zbP*Kq3!YyYdHZZI?Ox)3{(+tLZv2=7k-sy@b1!n$D6p&{cVQ6(qWZ(tSoP2uXR?NK zuJq||drWBUUIr}mb17ji<{R@Sjjh+(A%>aHB_D-q0N-jz^j)xmUKBKpRa9rs;oJ>@ zZ(ahQx*x26f;gG;(6!G&OX!1kngbu%z}~$BPo08(eH`=Ck6$(HiP;f$g3)fCc0ygr zyriCXcD6T$a+lF*yO@!kZS0z5{74b>U=a8|8%jD4*nA6S|H5gT2Q_^MT6!U8t|!#r zj7VxIu>0S$a;e-8j4Um;u8sMQp9;xS=HJw%{uxo+U4~!wR2c4PJ zM5eIIIY<-rNTMUktY%1Kny3FKGzQS<6OCk5RbbA#+pdUm7mRLH+t4CDf)xt1xC8=2bZ-( z$PW2tTpt>%){@{O^PY40v!wU^IV!~K<{42d% z$oc6%wx>wiy+t0D>H%qIT6anx=8s&d2D^e8m=CDjrVglG;VAF5Tcq(x%I-mK;4}YM zN3@cSlD-{p^o=g#sjC@N+smK8C#_fHb#_ORUo2#;>Lb!Oe%UI6a3K z?p;pKTl_qW_XE|eOrM35q5`cY9Je{6Z>Ddzgx0A{u zVB|^{aiZ-2{}u1-rQ`h67_?^kTRxzKs!VOSL&s1%)>ru@zxDj3c|3c8j@YZ0Bg0v# z0j8ZC^!!`kHVcpe#mrKq)bhx*<)OtN!7uJ$rK6GKnsRcCY17AKjaB7HE5rAJeq4aW z_;)Ci5O@(w&KxMmHPETCz^Mncw;UXqyh31MR*F^_d(PYU-d-tbFCYCmRz#3mneStt zCp9nk#mF<`B(!@fd+gS~7r1U^&dMNo%oJqJ$KjYiagO$*DV5`#9Ym5jz^Qu&ZT$vl z$VtqkE^9Cr(o6uQD5Kba2TS$+8#`~0PvfnmCD!>n7YcX}D|;Jy_$~G+`_6vFUytG2 zxCY6k8(1Gw&vqxYRAR+)3?rKy8#o)VZZw`Zcw|sNbg682|Eo=>1l9@<&*i z{i5`*byVM}^1L$?BGM=;dT3pfBWoG4^N_J5)JBI|>)o=peh2j8>Fl9Y=t1bvd(ieT zc|D4pd<{?;!y5XqyHpMY&T1OcMPtj=x{M!J;x$qz^)`9plrywPEada`?B&X^lRiDA z4*HALdEHSfqKVyl)4%7P9fXwk-F4TitsE&j$fsrOr2Uiaaeh8L;8tEY!6nayj-CLn zH3!oAr`7%JPo)H8A0aDk*oQ~%CU*VAyHvK4CK=0R)|8PzMol>JXX#XCw`n6I> znZ!5ypt)1VmsjSAoq^8?PQXpfXAU_20sQ1k&W5MsW;FB3U|?V7R>a95LWtQd=YFA) z;;tHXiplzTjMvv|Wh{nqS5kBBSaKS9N}9D{HEb=1);H~oq@b?$IM4nL3}24)R*38# z1zq-2PTZ4Np3a6#9}kAN0~e{~3I^Dbyg9quA8Fxyey#@to`*C3lNG#$jP)SA^-3Up zJgYmI-vfD$HPJ_Lo+n~?yqJ5W4_4pr2NbLhqW6K!3SKplX3WXgYTN)yFo1m<4ey*TC%_g175^7{ofQ@nl|tRXg|a9IKjJ zL3kRzsjFE1Y_z*KptY}Z{^m0G$AG-u?#Ci0Hf5!1H`d}Z^9X$ee9l7$EJJ!ZlU1CG zx8)K>`5XTEt9a%$tWkSW4=}4Wdt6=o=c(3GvqnT0z8eVMO@nqk!iqMMWtL4uOfH_9 zY&7L{SP@?5o9mEO>~CSO7(EnfY1%8(T8m17%17#n$~$s7t&M4=jVb*GQmZ%a0R0JCq8Ce@BbVozaWslOp2U7BXFm#zu#jQrw-fvK(8FJV z_P^m(Z-Ob)*;l(%^uvzPFj&-$uQh|%97@lR(OaHhqdU^57&T_kxzd(d5!!IX=k2UU zzpYfmNML(A$=!@2RTh>{DLLb3EKhc0kx35!2b5%c0&EU0Y@W|ZUP+JjX2dk^$2i_!H&u4C5rmQu5`YQ;|GWOrPtgOM-R2vvf!QmED= z?46S1V5zLlTpD2mvcJVJo_{wuH81O14ptTPlV(JfoK8H*`N3{96kkv)EIHf2-VI>j z8}P*|nd?-fQoDxK;)lNFoC_(vImYFftsc{T%uX-8blV^CLz`v=cCRB^Nt>XTTm*-@ z6N>T?|0e9*#T$AaE&!rjZ&a~1>DOjN@mvUOESN~JW-*Ya*mXfXk!!(?xvNR z{#Q3F(1jw-l~uRL^D~pD-Ur9N5?sEA({U50#ho~Tb7Q3>E9sVn6Jd;OGtQd)b{hJk z-lVTNCx3ubz8rYVPKtz~0+9y*Kj7n7|P_ag{VFt@c4(I8L&)TkM1~21+y) z%B=K#ADqr{&f(k-e@Rti& z!_DmItIXzoc-gmD1U92}u7|3wLXQ5DPhVrb%8%o?qbI&NYcJUop&ci+DX)|H?t0ex z7*P2Hj`j&s_@lfY zn!pgMlZ^+Ec3nR9;%7}gFvqN+Ch#y%GMU*z;= zTFc3eKk~F|figm66S$@vASLjVmHe%R*%&3MmvN_y`Ts9)M7y6AZWeOCXT_*Kbszik zde+r+?AS-dI{RQ1Zo9j*hptcNjNB&`!}2*`FRD5y`7Udl6^EnJ)iS!6&@>fm|16js@|Bi$GJMEwgO{$q?+oS zMk0mC>mXef1dKg}nV-k}?`Qv?WH%oL3!Vd;{?5;nV6xq-hQL3X@w}RhV9pX5Ks?Kw zVe>OwrB*@hIa;%ndX3=M_wJ9LX*+<~V__VW<92AztKiEzEF;*vqZ&vs`_Pv*1J55h zpU)$kXg9wtSWK>fK2GJXGm$z*fWJ*SExCas)Mn?knMzaSUD|t7?Ob`m=xDLP7&SYa z{x{6jsBkp}>4%m}?agxM)FNhXn{g0!7*`ul<6DT70MbTNTU)R?J7>(@SfsjH|C0gd zvx*!nuJ!O*D4}VE(0h?^F22XF@d*1o3v3$0&Y9I&7&tezvDv>Yo+CFmD}NJb-rfgR zI;sTLD2J6}z1BMK%M(vvuP)-bC&4GDLOuEhUR#14$IK|}(2%7SR;=Y(tB$@y;ok&$ z(GjXP66>%M;1z-X-N@;l#Jls6-i9)I^S~_%8K)-mqH+i}yR;6wr_3L1g2s?oSFk#? zza3oVbY2(0QS6QQ1$(+S%EdBM9m>}di%g7My^iz$D?9rzm}Pd}Da>IE+|O!l`N$(y z5{-Eh)owX0bZ_7^Q(Xz**n`eG>}{D_7uGNce3V*@Wc^ozA2YzvF;Lu-m_sk1p}c8b zGwZ!_I+(4s5asmRPwl+a1*i>#N1OvBgu-lS_|5!Gg}zMzz9;b-z*P;wvV34ilo9h$ z&s38(o6mSM;cFxbd4TLvUEt81wODU^5c9c|vvVhNdxWtc<1F3GyQ}zp7Vw@9T{#J^ zGm!Q7V?IVB^x!=A;oTWwJrm)|cOjKO9%#>tjC4PLJ<9375!g*-rDK`l$w+&nzy`;B z3_7G9@-^pach+`j|4z=*cgU&#;tb!;Ju?E_dP4QBg6(;<@-nf4!V1b{&ypN|>!GR% zwlwDn1Hgz0%xNZE;9f>~o>@E-^tH#B**&c5S?K%UxnKFq3_5cS$j@LW&A1HJOo3uW z=!AJwW)Rxn%IF>Q-}OxTUQ6H(zAw+U)*jM}u1_xYCMw~H!*;qPV*u#uk+A=zvA$_G zpOGr^O|lX>HAe6oRc37~V!Rm7I2!p1QBcl9ZW=Hm;x8h|f=$hOb7bf`S5{&TOSA5+ zM`%Q{bzhXY$aChTX}h($f%$*xSTRqo&9zjMX5QKwz0-_aA`f_yR~oxc4RxMv6tOiW zh$IFp%k#J1NH9HIDaM7^%m9z_{Fcg7f1NA6FO63b67s9G7DRde(%);Oiq(_Vn$>Jv zvrizGgE6cFV5VAazBl*6U6-PV>`q29zWxBaFBJ7ryNAm5dSk4kX(b!H5i{f^8g2P)yWfOjrh-jwRV&=htA5*#CJPyp!H}FBK%Ab#`;JR-kxbexJA|Ti0vf?ic#qdu`=A!zBW<$=b92$p$)XUylz5HqI><_myftpkXdS&HRyW88 zmS)eI9ihHu+;|o4vDbkWMZ(O%%mX}uI(4l15Kv|$aKS1_N+kBBpf5;>#WH`#^|;5b z$oZ4w$DLKVnyl#nCo9UB>8(XRbo~N$bcqTO#7Zg03*$L2q-JLAJdDzI*Nn-@;qJ;n zg08@P<9SfBw;DyvOzjU~_b%g_53q7;OQq5K#K$ueaorJ!^5#_mT=Mkz+g%O51^yTJ z?SW(kksACZhFj@0tw2?q(`}amDS=5X{7~s%X%2qn1x+-^x9M*zL9Hy7&SBC zOxqZb-C%B>CFL;dMsi-*Un?|JWt~dKwW_#MON=?rR=_a2+zeIh zQGp7XH=NeEbQELoy-K**kxQ(yPfVyf82+bL9`gxR$Qi+BxFgmo&I{|XyMnb#)eeP} z-Jy(-4^)Q{jb8Djs1Iu|wpt#im=$5A4*TK>Y{xx>J)s^^)_+Bd20H|0oyE5m(8V2@*wYHiy|E!Zao31sFlvW+s=5#I5y@JJ5iM=+i{1_*Qaj2hq(sI zXWnC$f-wz_JWWO*+u_Gkz(|~7A?S$`D-+MRC1wXWNG#%9Br$!5HzF|?i=^K0##q`s61kkytY zC6)fzgF(*WHTJa-?$#tS*TXshblMDmS&L7)Z2W?n2^l-wlglfmI#PP)T?{nrE?|bA zv|cz0Q{g~WCRSR7_rlbwAx65?<38)`~J175=y42zu`zTd{ zmdkPFLQoNCH4-CNRfZpx5AzW2R@HJ8@h62SQWH-Ve+s$N=PD0|idBs0i4JFs+3EKZ z$E1{U3(v7n%;D~|8(}?GE*5Buc5jt8$^#d5So?@ewX9btob5+1ex^AiwfW5X3ME%( zA2DLv;lkpASIbE}4Y|k;#&uX%2PzHqmPa08l_|zl3mn|{(wh2#TPqPdYbzd*-Ne26 zq~zlG)A&ZIB!#${bNW4uh9+{IwYi_>ZkY*XysAC!^dLgz;ioCLDo3QT`)Z#)sxk7p zvSJnZmej|wfDz9^76|u%H*nV-oIJX-@j^P`Y-)cn_K~@9y}8I%=20%q=h;?!6bqe! z{7FeH!|Yv&T-_e(L``zNvW_bd%hA>NQCcBa)7kP{iObw9+7%H`j zWoW+04#-Y=`;H)yD0ijL)-q}xpfm%(Y9MqCLbD)#k{M~w#k0t>wHT3g%X8Gu&0@0x zv62(9;9OzF7rnmgxK`hmc4DJ=^z3O(P>;3N-Zrc++Nq6$b5%zBSToVu9_zTm%8Yg< zR{s%i%wRf#PHEhieMH10>-AD`j%VukHh#h=jXxO$hysDM5~~reek$CI2{R%@`-}Ak z4_X_L^&P;XVNGRY@yNI5y;)7x+F8RW_Vv+TqrJo04DOhoaI))}ryZt+H+mDcXn!jgLIwI^x? z!VbuD_Mp$J*B`;&W9?=wN>;YgKW^rQu^QTh%(q$xHW-g(&2sHp#Kr+zqqxiya163K z0&crr@j^IRfll~(qKFmXb0Z1$p^BSY%%L^^+X??l>z8vTfxc&g&-iVvC3OQl)Zn{P zr&Vdqj|Nl18Blh~VFl(}8fB(VX*RpNEZvg>RbbXiIm-ME7*)z6bynK6UMD*bjjP0* zsX@eS&2~@|muHq^RO|CAA7EGFPIdiIlbQEMP$I9g3syexbeY*=wz>9zO}xBYeNL~W zvbG#Z9#xsE?4@cQGAbcK(WT__WwkKn7Nz%!Sir15Ef=;&v+>ee>WlfL9<)Hj}Se7 zn3(cnton(>Bxg_L@k0btkK*(De#Pf%c0XvhL zF0;vod7RgEc*{=5W01|b>+l$CVf1Xq9>i6*P}ATA;@YkurmbIOzW#E&8hW5-^4r%x zvlie*YC(R;ljM|sL#E{cIv-?HS>Z5MI6K5$$*etto-7x{XU6ByAHGpMBtDTm)DhI? z97sLEW5`Ht9%`SpqR&h|)kl6Jr~XE&4&^YLxp;ymV--FI+0Lky2JDkOQ40orXLuI} z3BkJgMyvM(-df#;VzC;``%|&Mjlym?7!Stj*xP#H7axsH?|3Yf*0HhsoU*i1wY%Gd zz0GI8^?B%5Kao2pVHci;HO*+5kyy9R;FIx;GJ{WVz&ran_SgYLtUpOrz^$zNV4Q*MANB8I)s@2w}EqGs40VE#GC_WQuJdBj)tjcO6G@DLuDOR-&EjZN;Qto6hN z3?lM!VYHVO)(-jclcQr;&pbR}GZ}9%Q0)xXn|t03NE&J6{2PW-Sj_1}o8xSzRu?5? zqkk*0Ha+CV30cuXJ)|1r9LpTL1DoU6{Zf2{&D`-oq3z78&Uu+l0fQaNo;_HSASH8CEI_s|D>OW29I zXP8SD#_Wa-)n3azz!GOR9vD7GkJ8Fymc0&S+R~r9EY68mQe&hH+vqEJvZe%VY|9)v zVP7`7*6!wN7iux}Sg)Ew9lmp(omj;LEU)vZ9-V_X`zB7q)6_q@5l>Bi*6&zGF9B<` zXp>nMFr)?8(+P|4Fs!!cgQ-{Xn#42vF_N9XJMy%StURrpl^0eG{{RA3VpejZf)%qd za-%nQb!45xIWKKlUkBFentK4r6WEhc(6nLTr}WNF+g1py1GL-oV+DZD+|!v=S)s5A z>uU=(n7LqurB=MuyUmcbnkOAaq09AnXSG7RiW%v;3T{QsI{r%eMGH=6DI>PxS?X-| z{87`lmR~-nq!#n-&a=m2eb$q6GZy#Dng0a#&DzACq+*_I4@y^Py=Scp+89#{omD=p zEoPn2Cd}84(WkM}X`FFmUGBuXem)}(XYJA<`vlYj22H?hLqd-~Pj&QC<`-9ml27+P^WHJP)i5;ZI8jGyYwaQa3E zxEo*Pd7aG9R7M&GM%D}K*V<)1s?mpfcC-lDg{3FE&<@NOD^3Dm?7-KEedqwzo(-H9 z6G?t`w4W;Zv*RDh=Nm_E;M}M^aS|_M{h!EF#{}wkN;pYodh6He!m90SX)h+bJzG7m z1~052oEqcF%@ZKU1t_?$>NIIxPvcvEz%z>62e#|ckqV6l$`imeeIXqU)-GYaxD>W%j=wsItFV}Q%Ogotxm%6ZLRJ=WgS8slsiCD&*v_iP&ec8!( zsD*F}{BAXH9z?gwozxO*g-6*ud81V-gNfQWj^(~)%&s@{6X)CV-t3D8jMxE8vO8=K z-gRbATk%~9Gil0s))Jy$whVmG%c5k^kSjXynUK&rqvcQ=mwKDpvGSD_Zd-G*dU0Zn z>YB#xoXUDSFq%Dv)1E_GL285j+Bk)I5qDgi^&Zj4v*=B5EOq{0U?00u+2JAbxtihG zJ%{Yi+VNQOK3}8~aye>@mcrZ50XB_*n|&`DGIt{a`T%#ksSjg!n=yN1e8lmg_&apuP%HuiU@_Pz+vN3PeT} z{&dn_l9Y?Ti6O^s?0#c?6DsU3LIi8Z$4c~&*I60CMgtpo*}Zu7dOpypp2`_q8= zG~}lvG-@a`XAgw^4_^G%t z5^r@PM*1^zEel)VIBIHU9vuMY=Ax)Sqs{YU9}nxLYn{}NVJ9eQdRyjfKQ-5_-LVAN zj)hBXLyG=4nVna07N^H$aO~rWshSNH?F=N9Xv_ez{$dGZWwX-ey!x@Lr$Ui?0Ba+X z+p$+&*zL~j+KHSx0F zU(&4_Xg=7TS%o=5aC)Fc{3m0o#hRUCWs$XLRQdyrNVn62xeD{)Dqn}J13gK05h!ME z?V;MEI5WpFyVgJj-<4V*y0!TM(NJy8zu=vo?Uq-%?5ReJU*F(gl8E zoQs^@m<-PXD)T%`t)IWa-`6d z4T?|eb4@pR=qTb>hC`vpb9N_#M{Sv5eXgs^>Iyh{dabM(rgxx(xwhq`j$)3N!Rc=# z)?_L_gOJHO0=dhHOxYPtM_&9SIWL({{qis9WOXgtPeWwJ(TuF`L%V8q#wlhm^`JBe zGc>-Si1oK(o?5DvF_gHwvLD0YjuSb5Q_v~Q$+6$3RimwP@2r%Ejs>T>afiL%wVG=Y zcI`QQYc=EUjA^&b#(a~<2zs*q;#t~5twE`+#HdU&m!#V}n3;NYea=L6p3#I+tR}96 zR)akhp7j~87Vzi~RkCW$oxtO{5ce|{YS0Rdb!~b!m6;kdiZe4l%CnJH-6}=jad-T* z9cwKB7p=HroKRY2!Mae|J+)EoVQ#y@ZSxhJHNI5#$GsApq&TIFBQ2^g;pBVb|HAF7HT*1wEKXS(S>3|X3~loSwY>Z_N^G94&N0p>*jFD=7FMR z0b6b7T6gttvA@97dI#p-t>KKB?{9>zRjbV4(-vz?y3xF5oN6Vj36zdu?3O%DOl!ef zu#5v2ZOZtZuz4L|yshxkrDUsGeerj!9Yh*%4gWavX3&^HWE7K?#?l^4c2lyFrWrI# zpff)(6QcZ)<+QvR_2qX~A5{O`!EW2lox0ELL@9J?2DX5`RIXZr#(y2>?e%yx^-~{= z@`%TIj|davI8SBwI{+W;_IR6_gZW5S)YZeUwx#FSahrfo>POnyJ?}>8YUfY8jf_WT zoWNO}!fOKb*Gm6p80fDQYdjmJK+5{6YSMMV^m@!wokIzv9#_kkq_(+So6mf-TpRO< z4@C~cUrMz0#x){mAur<`=sFg-QVlS#2{fuFug*xX$MS6T8Ej0@LF-oi1RQ^7h17sy zG_Bw%cVEmmR&mfyYKLRH6wytE_g2p`lFm98_8!neub$C?9d8bw=o^02K$JPH*P$Gz z&qg~I{vhV94c6F^iomKe5a`LwP7P9}nxVb8_3u{Xnys8(D=01G_d;;scUE4F&$X>9 zeV7fogniLoZ``rHto+f-tDixA2|J*(0JGGo%}84c|FmL-nN3)&x!bN8)*~>JYjMCz zF`e#~%vBGI`=I5l3#;tK&UFSqb<>vT}zK z#`T_7VZCa^4ftHDsHM_=gVHf-K!CHuIZbP+ioKXhf0t52zBkpM?v82_cXbJ{Xvdxy z*Bt=^Z6JBfuZX$SXZ%!yI1^itvO{B_VrA&%!2DA%QojY&2!IXoM(oj6Vxg^Ome!Ur z#!TO}XRvmlG{eEUHi6!#H>>H`p}8@8F@Tl!g#NYViY~0xNK>=1(b0jq_EfdQGVblf zE^75q80e2Y@hF|E#!|26&UgV`1}nvj;tAN|x|0WY z39?al)?{Z6H9&lj%tSvd{&s#ie?RhMa(YA3 zR#MVN?x;$*ZGrSeBG3<`S1yl7p=bRU$+<7*Ggy9aKGf5}WP3q<&I^{zwl| z!Ts*2gt)^V>}lTr(R3DYT2)&go^uWoqLg&U07DEj^hgdvBSUuzQi7ynVuPaCaY4~* zU;Ek}SG`_45d%a*LNHJa#QvUVZ$IWY!_51>=bRmDul%pIc)~$wK&~yfFs^LZT{s!E zB__gCuaDk%llAG%j(d}_?BMHn*2W51=3|>N{_Nj8<6Yj_&j}GnQzqpqCW+&K zlk5?*26q+p(2%(d48GsxaDe65I9)geb(n)_WUCLE6H13JXkSgY3Fki_p4}NvF&z5T z=G4+W0-A4$W_BwzZ>J^O@PWTam%fkElc!aH9VE43+_@?3NmyOHmJbAQHD&8ODp6nni5YFE3`;x}LZ zd&dc{x89*S&pSBY^x)QpA<aXVss zLqOV6kMa03FWpaAXE#!7wf~T%Kk)Ww*Th8J#B*A-NVwe2Q<+ap1=|saZRR zxZs`WHhrK&JC@tsO+T#oORXL;Wepf*M2fx%r%=EnXh~uz2h(3EMnBw;a z!c~X!RP%>pjhVNgCVhSOz0guO8rdzZy_uA12=W7CLldB;cky9Aofhl0OLx)Pt1mI9 zZumKu^E6Qf0nDoZ z#J$96e8}9jC=bFp>Ov>tqqLQkOGfrV!*P{a`7sBi8Z=r6CqI@M&&LC*7qS?=7mbeb zSlPl;A1gitOZ$IuM=lGkF`7wey@+L z0iOr!${6KzN=$7v=!;WXpHb;M?}7APMQ4)QR0)5YsB|+lmkMy+=}9fLnFoktmhBuJ?ZFVKTpr_!PtjY@4a|ek#|~IdhN9zjT5(rx_fZm`toJ}AiH1HW#$bz z>3z6%B5B7@q$~L|=d&jul-UitCJ+r}gd!W^Yn%XU0*EHDn~g|8WvCgbb%wGKhrSS$F)SYP9bAtHRH*J*6mXgQ9?g5 zTB^YCbp4O!n7+>*e$IMeEwe(_NBkYCRX^Ots(`0~io~Idud)WV9uq4gLshJ-m~~I4 z78kldV^>2me@$;W8Bc-ltIz3`)w5)l`FM7!KXcPB(2QLaxooVoEI+lh^grlvJCfD4 z=P(v9`=?!J=DD4PTy4>h=;!bveMw4LvyAL6Z;yGgTO0ZPZGN-LxfrV-SXmLJO?dk0 zbf#!U4WUEG_;b-WmZdd`+m8-)65k{CUO-HLBeG>Q6*xyGzf$?DCwq7Xk`)vtYn8H- z)Gpwudh+aI(Vh`?h6Wn)x84<2fl(jD-+B)94=W2=aW>VFeO2smGv+M^(?6@Ut;u>S zeQI#G67ZVjk}uNB#uE`sqs*( zJb0YAa5Me&=8LZ9A6yBKaftjHdlymIlsk#W(e7S~9kdh;+&tF4j5?R=TX8ix89YIh zpa00xV>PV$XD0Q_NQ)1VBW9?fZG^qlt7_(PbG{q#Sh6#?Ry-XjcUH)3O*4q?fe`cM zqei5)T9z+I z@h@f{`?rc2G~YkS zAIaU@Qx(n(mspR@S|DTsbEWujeTP;T)3@R84R~ESD5kmzyI&YaBS%nEvnRYLU!qrh zTEv<4(2UTF#@qwdSv}TK#jaiz(HxAfd9A(y`jc{AV%$u9N^eN)TH5UG?YS z(Pjng-D*`GD_q!VCuE{>XR}xGp>llf(3@Td_XC~`ZJSA8pO5pl`a<7P`Z^Jqmxf+ga7RPW5=S#aYT26b=VZ~}$ zxp^yNg0lXAH z6tlC&x7LUltFlPG1Mp<)%c{dm1lXch5$a#n=9?S4z91fCdR5}9g@<1{a z?s7eRuu0JPtfK_t6)LF4UdksjMyQ`t^z=@iX}-7_V#ZvpSHF>Odwu-{9oPd?e7V)C zdtnKk0*3KVEd4jq>Ue~gfir1I_m4}Gw$vH84c;)4r!Dnzf@L7L4OkTJCC=3> zuI7wHPGvm-xsIpz%y`5kIBUSt(S^EA~X)E1nJSQc$8|Ji$-Ty91aV-p2fm37DP#v)yr*Agb{*P;CChL*( zWz!T7{R`kMyC>zi_8P3d6Yz=53>@TWW@pY-B{+TpwP^E({%`n5F0CW$DtZWc1vTOO zM6XhwSSziN@huNklJdZ>o)6OSY;?Q1Ab{WGtQqm_2u(I%gyuwB|FRL|)nj1PegIs$ zU$AjYkt9ZJTJWRq!*kXC7f6Cs5xU+ zMKDhEZJ;yzW>jXr^|{yS^nNW*XPkHGqCAx@T&vPqXcv0Xz9p8t5*^3AZWwsA8P#T> z=xMT!PVDe!#qzhIN=bQxV#Qe(W)g#Ms zqU5md8+rw+BNZ10PEmnV=@~Q6+?b+Sf1*V^C(3QTY4*bSB5)0Bz=`H?FB9(Q8PM;i zhf8Z)oDXL=NPF@9B7d!ShWtlsGA~D)T5sJS=m6G)G6UGWWP2KjFU@0YUD%Tj@b(&v zEsr^99o2!J+CgnS`O1fGJS#;!yIDAoX2X~x@v~3iXBKu|9l{+hX0`7iLe($13;BK= zD6{`z2d+r-l6OFgw?;$Er6%#k$#>~6kZDh(|D{)S9_X~iNo_RYWk?)q;=(bhjLd#0 zSFA*Aj)9rUvFqwSUNIZP3KjUe!4+og#a6hk)}nb1VpZ_O@hKxQN`JYaIS%IK+tY9{q zbqD2?S-+x-tpM;FBi8p-h%RwHbs@f>KFMgj>eu6|D8<6fL9<+s-~9x%#2HZCaHy~i z-=ciP-n8L0`>eHvT8r2Pd16cW%OG~~O1j@AU_!4U&tShOdu-47Nlz@H=ivUc;4uY! zTDfO7dCV_0cSm2AJ+rL}Y~GSF8nM25YV^t$aXv&%iJ6t#%ID1g(BEoatK3tojqF(X zguQ(GhEeu~zgg#GI)9IYHy1H_<2hke5tZq092ybveTfIIuod#k;;u14#d zaSpp9|N0|amSEW}#cw_r{wXR`j&I-IX8hfYdy7anCU3Tao_+IJtfU2pVHeE2t;Zdc zuosQEeiXcVF5Lb^bi7`yW)bg;#WLUPOMY6F%+B0jhtp&gX|v4CH84xaTp=T2=F%#q znsNtGw*C3G+E^Q2t;=Y{-j{-GTATAVyS|V-f`ix-2ZIN1PEr})(DjU>h`k2U#?#eP zl_hGc=DUh)_1x*Z!^^`gv`Ni1Hn)%%I=c#Ho>fyzLhFOx)B=6oIat4r+&|`Rj-=MG z{)bM?`;;K7ClgmHkG(nwODBgudaIIlAoTBNO+<otc|EQy(jk-fjt%~AH&LsI+Zt=`>Ovm;T}rVvaDPg zR#FMtm9;VEAqq;JOs`?g$Fhr;RfNpj(@RZ0 z?BS=`*Nu@U$3Xe_fe~&(m(VAZFUU0c3l!;N_)lAbR5%l=>x0%|_L=!B#>uVrK~-6} zy!d`QyjW+|x&_p^=M&m8)u1ru%qR8Rkuwe-GYZ-WYOpu5xW+;3*9_LT5Us8W{6Q~~ z=RSI^%sRH#kLXUj16WttT7!DstgnvL=M}ODxw0uwH49!zsmD;OL2aK7r@X4Bl=8Ry zSv?_Yl_EIB8B{}JcHrdelN!g@Y}Q$Ci@Uu5G|8*ztKHyz50NYL8(%MgU!O#uiMO$j zr=uBn;pAvh)a5&u{q6|&mbGOP*i=%)g*hbzP@_U42PVhx6{+C$*K)(bJ7~&KoV6~L-c6W^vGfAgXaICr$Q|?)aU#Ml1TQJ~)B+SW5&drN z5_B8%P5iICSCy5}pIM)4^*o7RRa+wa9UiGx_7^j<%Cfqu9uI2>+cnA07@ddzv%=5; zs~{SQ=X09%@#@u-KlXr6i>jE$?oWaTnV+fkDA(2}r&eN}##p^T#HH1^iuhbVxJAqb z9L+36=GqVDX=$zx}1dJwBam$jfg zZKwu(wPei#ik6uu)3m=FQ+=LmpG31{0_uSKpjCk!v0iYIS^tH&9sT5b??KD38;;!gN)_l7oIH1zhm%9j*s0&nGt02f z`tasKi64?JI54@AY{EB*IK7GfH#cd4rgk45z)^h0ELv(mFlM@i^K{R9GgeOPT-{Iq zpLs?iTa3MksHw$!`hM+NCf3#pDEjfl?f4Jb$nW;%uuDQ!{@0SQ_h{_*Vy?D`2>Fc2 zfR2px67nVM;{iB7c>*uxN91r`#YhXN5%?@V>rsJ6>s7GMmeDaOSslMq7^xY71GtlM zb+e$%G1UKTcRcaHV*EnwYiLJI-BE#psO$xu$Zw(t#Ox9!P0Se6zi7t-d(Lb9=$BEG zX$&oii8n{DHEV>2jVrKR1OKoRw%x4uF>CYPjUI;TdW;or&8K{#-WoZ$sP1|^pIS)# zJdCvi9qjL{mgmt-o~@iyYXNv-SzA6QO*wbGjA(;m#)yitE=p{@E^u?^>0V0fbhh@M zj0f}x&rR`r$er~iZR52~j7e0pI9MYsb`-M5q!NnXxYkMtXd^tcdC;FrSSRt;Rog9Zz2T9wQE`EOWB{aGE^6{~MQN7d~T{4zHoOaF&;dOI3WyQCbkv%An#C*d<1 z8st+uykyj|W&Ezay|i{QMl<)#oxp1&y|ZuDLeRH>?->~&rd;da-K)iks>{8!XL`bg z&7;(>XWcEla;${)%lE+foUI*6jjU93SGXs&)A+K=gjufg0VSCG;TdyHtaYmwMt^`E zfsSV67g8(l&!mW0?CsF*A9$fY44I-6=n;7@*(Vb@=VUIiv-;-_V}x2+5pipM@-E2G zN$96`p+1^-^-~%>Hh!taZ!MRI#TQYfe_M^$_BG1M=u3?lCya)?KAn(MMd;uDR1N92%Nml(m$a560crBM^;vpmnS!>#BkJ#}J9 ziAh4W*547qr_TVyGxuX|jK^rY(Zn{aj55%i$CALidoeG#HS(JJU5p@hCbNpCv00-B zdKBz&X{Rzh2yzYUGef_umvW^!cU4n22I4q434x~V-frHI{UQFpAE5O;eu7%)Jk99j zjaI`@Co;-mhgY*7hhrt(LS()c(T3HaIPOXACN6&#e$VpMvAh8-@KjcGWRTffY7M!M zTD1P3*frQ%s8p`tuG*>kx~)Q>O{JZ#cUDBP*J^LLw#H!F@v5s>na?>FH90Hsn2GJK z8^JXqQNBq1T`_PnQn#BDP@1)y+ixE8#>XI2x@k&Ih|A5=on@9272Y zT>YpI-`)9J387b6S((SY%;4aYZ=bgw~aoumd+>QN zGVP39qEEl-&p%(Z}`ie#Kum=lGu%4 zJqV1n%w(vMrJ<~Gf>QEj6JmMoMz0@?o+Yz ziTa?i<}X9NdVLO`LUG3PtfwpHkc@ElCTL8YAn|2J0QK3bbt@r@b9bd>=Z1M%@ zuS1X%V#%5?4){BC6T0*MwV6@43qLYn;xWwFIH2Bmy>I#*?C7XpLO+lB1Y)czacB)jK`WW&Q)Fq|AhwZ>4F`@x6#sV(4)36QjP1ZKdBDW4Sn%qEYbI_O_ z8m_gKMuYc}_sltSc2$^H3&zzPnw1}P=cF${H@lvCDz)hKK9cD5RroUI6MJb$&gIkS zbaRjc)5D;rD{*FLfOR+*|M!aISaK3uveT{kSxQW0HTuUr)KWPWNj)HGL@kad z@K{dev~*x@M=(QmH9b9Y4WpD+uCgMI7O6fGtvKiPam0Nd#yfF8+WL+7?Q@BKKLMi0 zdI$BP7x$F&$8QlgFKSdDfUy}ZhH8v6AUheYr_}yTo^ESHS-HuM5}pusAM+Nd*v)J_ z$+g&r)_8KxV>kEVp|`X0HP{N*B$whh=}KJBKAU5qMzgGAA6F|gDPs;m-FEBq4DaI3 zpRn7W9P4*D1}I-zf-bGNBq~s?LEa$}L~pgUXjIyfD4X>mat;5BEC~G?7^f8{%zV*e zvD%+C-aKJOd_+b_F)@2keW)g5@Y*lK`LctC=p!@S#AgOw5{(hOZ#b87o8MS7;tT#A z^z?)5lsQoLcr)UwuTW}iz}@BT&cisG@v~}Sq?}~9trnWqql_qt+R-liiBIcOtqy-E zf;)FZ8W@ijt0JODU3Ukcw8k`*;24M5q^-~!m$2^7(~Y$e^tzDBLUXAoFcvOQ84d4g z?7NfkHT2_-)=E%czyr#zEAf>fa!7C*L60R80S|DswD67ji8B;iVCJFNRBMHqbF2sY zD@L@P>$QQ6l-hUaJ8T7PV@79XI%6*KOYJRtUTX(C>SoNU7>mv9(wB)ll;QLZCO$hJ z{kS~H#Al%QQ{lH_YU%}k6)gzQn?9?EPar>vT@dwXMH02PcFc1GxP*)G6n~uaagsxy zsxqMx(z9s1_GlWwDrf^ynU0^@wA#jcF{-d4A$kVQ?q}{+NRAQII-LAoa1is}IXxED=s?OS>BB-De#;^89 ze--}1kHVPrqts^id!zl2!a}$YztNX)ubO<>`Sxq-$p4#|usB=mS7|58g=;`xcEM04 zo4xog`y<{+9~H<^R%{nz61is`7v&8470*?hG#*hFuG0odC+f%OivCmaSjseY)rgC; zJCRzw(!{EFKEu9Sbo$^_DwD0WZDlk08}sr{)dh<#VzphhL~!2iDt zv)76SRn7h%74|cqvt(|Xw!8bPKgH9mo}ouc4aWGA9xkhz5v}Gu{VZ}JD--C6mva~? z6lX2Q8jm*DX_xE8wGN)xVg0^h%GJ1B3z6_&FcXpHe!@t$+(E8TfpH@*psa{Yjs38# zTqg$ES~B+V`;he%75=@bE3Vb6shy;U^-Eqq#AoRk%6-(&t<0r|#7MsSw3%jNz3p!! z-~WOqv#-po5+`*K(r+D6f_?ajI-?oQhQCaQ!!)F-{7XoK6<9xg1DBGHzUJio%3Z8; zBaTO2@lzO&HH@gw$X%@uDsL|fr%rf=$Rl~H`t3<{&2w zu@x;!K4COH%2Rb9IpNRTQ!W^N#YQTABOAd!O;!XHiz>c7W?)Fa=HHUd1+}Q*TLV`Q z$pAF73$eksk-wLR*JCIe$uxLi+oT>j0{0VI<4BXlwtQ%y<+ApK*{hDxvW)<^+b4zt1CO0ub3A3vGGf55bGHwe~;DB zOAdB~d;Y=d$Tf{Ok)g`W599t~PxZ5E1$n;hK64OS6w_=!EF+wDJ&Jy$ef+M)CA-oc9*v&*T(SLK0bw( z!sw0lSRcXa#!4TfjG#^2V}8@>^(pckZD9S8o4AV|1wVpj#Nil+BGZLW+CR{Ide;R@^oQ##x2pL}Y3ASUXa0puP-iejCd$W8LgC zeF*j&a}DKDVp-Ig?Gw70SM5Zq#Vl&I3U^YY7k{GGX+*LC6esReT=L=ERZ7?AU^P~& zvRIYV$OQ=Zps814hH7Ni$@n9Dg*YIymQu9Fe}xj12=>_)uc-~GO(BnyGCdERaej9{ z%?UN1SGhX;AO@ZfMt=yEAiKkjnv%D%8Klz{#B0qDqFM*5E`{r9ui-goHfV`~=E|_w zuB?4hJ%j!w@BEc{m~ZKs5}%<4sD_~&jlan?^y{m;#{3pfqZ+qYOFMFSuOYhvejrCT zmZNt@4Ofhi{UgLSks;2f@HFsL|2NC80{hpUQ(_-ded({jFH`tyJ?b4E0qfie*SsBE z&O&UoUhHcN>?AR*T8v^7g3iLJG}2o&oPa(cK(67;*ePvKl0#nCc7A@(Uyrfwr@@~G za(bI`4{V%p3e{f^vV-n~R8|(CWpjz|!e&mzjfT2>WamWvY z=MWyP#p#(zp#&?iw?e9wqKTZt9G;|8)Gyeeb%+ntNsdY?QGfJ#q6Eu1_oI-1E!;77 zP)f3N9&)9(Hw+#VkJ`eMY>r3ia+8H*6CY%y8V|~ufYN_dT;d>BO7Au z^iO@yT-ADw02rlF53UZ44}y;^#yY+O&)W;E|9|l{JdMx)4E)2>S@B}VrQM2#!PxW< z$9T&jDClR-j{SS(VLS&}BuYm+%q%XVe!Qa(O^=~Suw9J7wNu;GUu&F3nWF|JE=XOY z6}w~3#OcW0-8nn38>&P9ZLl3`BSk-B53j+KISlW%k%Z21R2 zt$w|OpXv-!&VFb_9JmtCYSqpMG&o~XXHlO88Ny10mjeGt~taChg?&B zw`R?ctdP|z?dNEmOiyx<@yx>Lu+j7xM5!-;YuM}V9XP@PPRu*-kh^*9TuzPkM6G%z z-lzflVXqi76pXIvM>UE-N13pGB8Ko@F~1Nyrq|Af7Bx3Ny@#@7B(do?G=}5D8E-8eDU`< zf=?a zc}~Qg+tZ>Q-qIx?#QzEZcpe-48*;76;$3YB9hQX(>r(ePgEv>f`cJ8{_byuAt;lCP znH9rT^0;H@D*@doeXOv99v7%UM6DEsCd3GL_&@7py$++Q&feNMdXx0-e8>FtT1d}E zc+4h7ezC^JQ_NBC!B|VNqF149K0=n}|L{t@jW_rSe8Oko{WCUaU5~nqsv*=bqIwKx z=R$bx&7AQE!l}Owgu-%o=3wp^{ccuaH-pgJ3@x>YC%03jcE@Lo@O$>$2#NmP5W8i! z%#n%tN9vWvtJK}~Cm3ngUewDSF{FR-`R!b5WY#!n@a%@UiK*fgLz`y7#%QnE>S{gZ zSxddEhx2*+|JWJpM{HI!S$12Gh0#CsMz@x=QXZ=5T3N-~C4OnS+Gk#Gy_%?Fh|-VB z!2B-SKwVcF)yH7BL-UH!LZK5q*zRcM& zd%&24=U&T8uBx8rnB|tlS9whypw_2GXZ-je*Zqc0{~_O>F`G}gpZ*bh3}{v8=@Qq| z7I{An*|Gxadl9L%1KGR>$+#O$`T@?;70AkQNKETrQBjaxP;2~*Z*9lD>{6@&s^ryE zWrblS_*c-UIX{0uvGO3Jg7O_HQ_iDyZ}d%#--wpOm~#1Wx00T~37hHR@gOM279b zH~%NU>jOI%{#}HW?ZkN&HDNXawGLS)sjCX(P)o5&4CqE?qxZ=@bGMwa{*T@4m{r8K z@wJl`F&3tWU=J&&*Y^--$DEwj*urCwog$KMf>&(8&-xLg+Cs$T5iHYl;0o4~%!Lcu z1;=`iMnpxZi*=2NHcvqGu^JOlW2Uzc&oEj6wgC<&-q0F4hrtcS0hfS-Itv-~IK1g& zyad0Y*OepBqAWi%vb-zdkNF+B^*&?z536!_h^|<%_h{}_z!R)1**M54k?QJ6y#u9B zfm8njPWBR%^FMThPmp_0qaoakt~Co@XMc0gg;j-nFp9Z>v){+bcn->Yhwq1ogWrhG zv>e@gBD84*L-PU6be2|jvzL1A^zLYr>$TT{RO6GonaS&!(B~C+QaBCU*rD%2Z3(SY zeSXr4a!X1@yYLCDkEoAd)Z4k2ILiHemhSR=QY@f6>pN)K9XHym?yfh^lc#R}|9hjx zuV>^3)?aLaf<6m+_Rx;KZ*(lTX8cZ$_uMF3_1- zh-QG8HLHDO&3Sv7sMBm`r?kqq@l?GedKS0BO=E}nZ+YF7QE##e&jD6y17p&gs+7~B zS6|cXq94nwb@{d)R6C<1N0_Ic2W>zlt@0{rXL2jdchxzAiy z>Krusi}_l`UG4ThiLb7#jVMQ}S%?ub``4^eV^X5dB34A-lie8Q{6^^XE9p^Jo|^yk zIWkU-REu2;PfwM2ZKGvMG_|gMfv@i7YAays#kLlkJ_^r~6%*wIUS-~kR-QfOs$+$T z1sR7fbs4_ob@)ElvD=R!y{=>L*TC6F!GT&qgEd(VvR61gqP*=7Xm85cn@MlKyM~*(p?~_fp+X%&+*wX56EIRo7;{5X!lnGkgxKZU2+g(HJK3PFF@{J=vPf4rC+W zqI9igSsi)O8)>u@8oK}qs6_q%X?zHOLq#5w@?#6duLX9xI`~~5!P4~N9@XDT*!{{BABoZxmJXs zdbBn7?4yK6%&YR8*sVg(u5#DxgcgkDI8Ml7=3tlWn~`R(qBT9p*E%#md+JVOre@rU zU9G@Q8{slT(GE%W5HjaRy-piboyo|{*HDVRk<|8;MSf1dZ`7@{PCQpp&mxiu#dx~x z#-lHD5BukrRVP5!u_|@|i`WRVE0`H5V`y8?hTdMsq^=HMLPrr1Vy9ZM&)$U`xNvTb znySl(4E;bGqN+r8na!iu%nGct@qnF3mF8RE=a0Z?UuH#KM2onMQ+O73nHaZRbO5oF zB4qWS8&@|zp|m#^s*d6BW;tn-ds3;a!Y;-xVEVV@hT61BdVOBjClk43W`UV^(SxWB zEvAt=7o5OyTw{k-byuVPyI3*lA6jAch!Jrj*y}(~Qhls>1*gIC(VozzQRmS55R32= zpSL5Cxo6h;R>s9jCsq!Le&n)YE@ti8on2g2Z+Ny{rqx65MjpM3-{?#HP&r8ru$|4Q z=$B92y#rX6qsRgI6^;BQtZ*3Pe`95a$q4NXiIf?doo& z_%^5W2Cr#<=#{n4tKO7QH~RAv?^IA8wKTj7dXfzApXczc%CY8RetzSr=HQ5D zs{}=v7i!L6PyF89;jZKH{CRRN#Y1ov7>&EpW9Xim&*2$sp_;W|G zC|bNmv43Y?QazlPRq{L-XXf|7QPleM_@PTOBkSFYtZmG1wb@HKw^fJq%gU?ev97+l zw0Ug$+vIopUG!lbgfA-V2eE)Lqv4`Gh!xb^0v@0JF@HxNi2iO+ zf4s^b@lR}B%t*I-Gx15*NH2)qXLEM+*lTCdDVy~(0_Ew`SE@#5yoibta7nRK5reC( z8LQ01ED2Z9Q)=}nz0V>lzkxS;zPt+_6DY`i&>t)%aiVz!r=O9VscYXq`MYO9G=YA$ z-8@z5(q||>=NIT$w7UA!uh6z$ATxGF9Ez1RAK2<%)}UAozq|#_!hTIx!V{$UIdHG> zK>`)AiXvU=2YM89A>GKK^eEVCxCXz8l=OMb9qRdkb6h(~m14^3NQrm}6_cQ&%LxNN934CuI?9y^PZ_my>Wd=f-N(BjGlk*pYnB zR&zM8)wD#VTQ|)Ld!RM>P1-Tf+B!wngSCG}5q!IZyUt*@&cRQ1D`(@OoL7*O+wl^- z#&552Djq{7KFY~i!Pi-w$Ps9^Rtz^6r#W{qR;o;<0uIy|&xTZPKBBuKl^N&OlY*tr zJMd0cI_4BOnS z;3uNvpNC{v#BXzWeKdN8eWa{&XSTLG+L-le!oFCS-@2eZk)b2uD-&34JLe5UKO4h3 z+LOha`C>J!gJ;AsA|q=v8>^VmkI7T6{9_h!h9mi3Ut0yJ%LsqWR}i;vl{GROIUBJK zf-4|mMsIM;zB2g-`(r(Y_UzC=<~@ltOV>G1=F{)fB!A^-KaKfeNZ`TlEybJyDQT#Al(MI1#2EBrg zVgJh8(Ck+5spEnrC)Qsovd(KB-l(^!2f*d+tv67+@ zAgciBeJ~rfA@c?u$Xc1{Wc*8-60tx&4WG0Ir)Wa2GGbJj(`&A&u_bj2Y*^^a3J==y zI%MNJ4bY?L)D7hZ$SUrtCj%V>&VnbN5tspj=Sw6xSrl#O^Z z_@A@GPsYxBo_;Me@8(knWoQC?~W@YXH*V)W@6W9YgDn;yzYwW z9q~!{Qy7mZB7M4IL0ntoJ<+ogBNMKsm7VBq&3jflF(xUO7rkm!#rw!*eTG|}jPFH+kGm^&N7{b?Vr=!t z>-FBtQ_YSiAC9ruC0x9v#yNBDv6aFj!Y_d zzOJs6S{4c8%KDml^zMjj;y$W{#uZfe=Wp)w1wRk+IafuW&##PA?4eOeD}o!@a__u@ zx>nTH)W3}W>7O;m=AGiGoVj|exOnlR#*X#N>(6yPj4CQCjgT2F`T@F@N}{hl(w=kL zhi68wl{Szb3TN(WXtzY&&O1vto-pI`j@J3I%j}`JU8#~z)_faZ(~GQs$)~#KF*c^h z&v%Ww83&e9r4#E%i<5Pow(@OfYFEu`#aKuK!S>?QdaK2Ps?UlW(Ux}y^u~wWDAvMA z%IADmj7f~0fM@3~YtX2t8Uxn5CZ1VTp)qaOHX_gT35!z@)vVvlxV*SSM=63={FFWP z#5GzEPt3D%8+~OWhRpfe7m&@~-w4n)KD~oa8%y$9V=+b`jcE9n+(h)PSZJe^Mwg8B zi5~x+zxME&8uk`GEjGaF`(N>;7w=F&Q5qNZoEUW%YwrB4%&pJc_0x~-2#sNh#&l=x zR4&Fqua?gcrLjGX!#q_Hmd?i=Gv4Sr9^kiae8n|Y+mb@1P4A-T(-{~c-o~qr-H4NG zyp21FGW&%0q|F2T=3Vqi8UuG-_i%Tq<2`;CBWy+SE&LRPp#O1ih=#l$)?f!$ZV784 zj>H{x6rb|+SjTxgpB6{^G4JfbV%g1KuA)2Qho4F0Cck$hH22pYFbWNkkslT}4{6 z4!V1?nGuSNa{f}7Sc1)AB#!QVUi*Z7(;w>{T~F6)C!cafL@|e2)x7Ii?ZRU0$UKKl zJkN?DUxerRT<2sb6l3L9#y8K|X~DJhq*xHrQT7QH4XF=kE8pgp znt?12*cfPPYq*)h0pn_oZMPU z?zyWZ!pPM(x-aHKj_aOzR-BvJ`?1oJSSK+qQ6h`bk1|poCcfH?1J~MFMkuEJ z4>AtuEZr^F^HW}lXfE^SD&z*{)i|{kZ>*+Ibtr*V_>#t;DjKKOOC`Ee`6*xXJw}FBsE#HNa#y7-Polg_{YpNjeA&$VG1jFX z;;A(c*v~~B;cKWszNH@Hu1KYxXV*uq$T2FRjLI6#Q(ul+qcfF;V}#AmsGUd$jz)b` zda??HI#Hz4j{;q&2YMb|Q>jVqD#l#JT)J1GGEaElh@tu5+78O}m_IKS{}t}y+B$mw z_a3g69r3pCuJbjnpuXj&w6{EWN@=Y}f2wJEwVLi%jKqkDSQT|FbH#sVRicN_yNLh# zh4<8b$G)9a|C6 zsyJn_>G9R@Ik8_Ng{={9J-FCSz`N*y)(4;u+>VIaRaC&jQpDnCe&*)rF|e|Zu^Pu{ z_MshZ&0{vJNnemrX#F>4^29nfX4;!`ZY?}fsg736ms!N-VEJ_fz9TbGMdKX7eXY7+ zMGJADcGDBdYv&K^q?`R=?y*Qzy%}~utb^CXx~xV7TZONf18OZ`JD~RFHG52s!^blj zkJqt89WKVR_YeFrcM?q%oA)(XtukO>TaioGpNxi)paS!E)bzWS46Dvb zWg_z1@CQAPCw(2UMkBf(ff=jLUFMKOzLowY-RV&=gX+wK)8e!NUFCmHeoV`7w@&FX z)Ye`~|B4A|U%D}WO3j*c$WhB9)|rq~TZyrZA(#JQDhW2AuhC%clb_b2uFd^aeC|c; zRar?{63@Oqva>WiMk-)ry}o=2qgN^lwCYA?cT zb}64Z6_4IUc)KnPahKWLZ5f`e+1zC!KE}nY^L+lF#fp!>^Ed}T;3-7g?j?TuGg3H{2@-e-7Kc(8vKgm2Bnp7m#^CWSZE5j(x;O9w<^JIL{r*Y>~c-nc4Q(VqPjKeOC z%bA58Ozl5X%5%ozZJmr~P4wkde6MqPe-`69o$HqImp;$&{4`&|o(*G&1`gwED6je6 z624C1)61FFSzNP#r!V4_>Ab#}uUV{=HS-1$N9;<}s3Skk?HCl|&*ONuxzoq8mXrA1 zQA`UXIGuROqwG;HGV)(c>(fJKetJCp7aJs7sk<-)Y~Z^@p3i0d9q(EA;NJs3Sem>> zcbF^E_p*vv_4H3_0FO<}(Ve~{v9QO851hgbr!(pvJatOg!R5Sq4*Rr*pC>R2seK~v zjbem)WJfaVx}ds&e+rJdT(+I z_cNn&={ESk^vU$(G(Xuw1=04LzI%u%ox&KV;um&zMAb}S%!9*@S*vaYb2^*Y)7z}f zB>H1~!D*O6wYmOjJ!(U~pFEws%-N~TYiqgxE9niKk;AD$H-?D6)gq0eOyKS%?3-Lc zueebc`?R-X);)RpNLFhGyB@pa9?$C8!?+*o(v7cTHDS{t~z|melo4Ohp~qNc&BFu+Lc$0 z;_0J#zPl&24#lT_Dr>b1oc?OM5j9Us(=*d^(s5~)JWKv>O>l^wpHsNULQap^5b-ir z>9d2{WbQDSm9)NQ5kE^AM`z~MmvMGyR@Sv`2B)@WYRcU0=b|s(C*|_f{3&Iv9U_{tzxBD& zTAV`|-AL{;ogEnqJ@w+NA8R~;Gj%%W?*h)B!{Y)W=2Z7hL&dW<8&0T3LBMz^&l^63;hhdO^!+k0@W z3z*jle9wi(P-RWuJs?xBt-5GmV#$~R!*_w-Z!g&FOx|mNY|AsKmLQY8+=0A~F z&IfPtN9Y?j4=Vg3OVSV1mDERFozx>bd_HTbgc!$OSpTGe|Lx!`n&w$Fp%v&T_hb#T zGqSbWXzZw z@t45K52X8%78B5du1qS2JdYEZff2Xi?9l|q(leZDF-+d4J$uoS@7}!AgIy|S4GQ^^ zXS50{UdUMb@zs&*MBKNA2U!2fbKe>c*qS@F4qVS3QjtTdDb0mOtyeOWU78%uk{x!6 z*{LDCb`iOqHIlQ@)TXBoA`AaTf3L%+2h@s_`4&;Zm0Z0HUa*+|Phu~g;LP=)Z$>lv z%zncxA5K@MRg$ZdHeku`V0BL6c~iLWB-UyuPwUT|x-dWIq73QFijCvU%;vO zyVm1u%atwo-wHSNSTAL1Ay<1AjD(x9*pXN5>L`myUW{w!;a*GSiwipcTY(^ zrjNiC>0RlXv@f;LmL|F6Ijm>q(~(|stI5!u^7uTs!)NHW7a;YIPj_V#v)i((vYzQ@ zbjSKIxyaf}^w2pu%d$Dy{n?e-G3oZSeR4B;@do7KsqkrQ7WC!$-56UtW?Y>$XvN>L zACMRqt2ZhcCa|7jx8^g3$*g~mKvCi!tO@GDyF$j&fqAL{iOe$}-&*v|8FMjn?GNwj%UX*!v5IFd-%S{;8SG{uSQpId zV50fV>$f(fb*_zoAI*+ylbpu)a(IT=#}e*3gnjV!we%CNiUiq+=KNMx4{204-AFga zJCokf&7E8`jS<+RrYrZ8BHOZxBC6%Jj-nIiz9-`w$1M7?XY?xLxpq8O(`n79%-1k; zp%H&u2eJj%x8q(V@UNciX$jZ$;4X!{CU5A@Ihn#!=dqsuLd)HT6}K|k#|WQEe@zdi zFCr@sQIoPJ)iPG_$&uWrBX_VDjoJ6+t>!XHYwWjW1*D=8e9n4FL->+|TLau`!cACl zbC;U3rk$9Rm44j^=P6yt->d>;^;Sn+%)~-{j}|!ckIeqjn7+y$__tP3lIk{4_`tbtD`vGJE$l9Z?ukw z(*^YSJ|n3C=UfRz9K#HY!`_O%wNHr%I;&o`V(f)s?8>+aoW_}qu{cnq+PQtpL`CN^ zMmx~BlAbMhqcJOJJ!L%9sD`F*|Lvy-_lYJ&VoA;oH zoKL^4+tJpV@;w(DZdm$NHaoi|Ta9-2BwbUkMk2fjM>`h|FM4hqG%7cswhgl}X=aZ+20|vK-uE0kqqT zwXr^zr{B7%Ry4O4fKsU?uiN!ad)-crefV^LzFR{BuBx2{k7OUDcr`3>ZrVp;r$iUp zsn9HZ`)66b!o9ZMo0^ros_tKd-Rg-9S)Fq*naVgP(GPS}`arq_I$xU+~c@UnzA*+(L%#K8cj;2fIY}Wq( z6mmwg8(+a2Sq(Vku5=1j?oUlBVu`QeTC1!KV;{A_?Ap?evDj(nRCEq`z)tA(()32E zxc3Qt(sR+_-b#+dx3z)YekW_r{2Hfkr2VPI*aiIH^~|o66&%LTKHRB@y;b9oA2ka+ zzl3+Xhk3{~-Antm)(@x9y>7vdsZsk?ikfkL<-0)bwgYefD9qE~OYr>w~xFyAP{55=x%P9(3W;N(cL| z9L-3z2>S85y|!C(tyMOyfLk4^w3|rus>-X{LTS0oE_5VAClD8=f75IUG2B*$IRZ{m zz!U7+rXDbh9n`k(%ag3~VV%MDN7!^VFe z3#ZK6<7-tx6p$EjHqv z=*RWUE7$E?YYl8M`#w?Ix*2z|=Y%L%{jlTN!@j($E@@r(nmpY+Lu<6_Uy%#=Tyy(H zx!S|0FX#Gd&%Dsp zZ(#ZX9O!m9`GWLdI*_{TeS$4G3Fts#Q4cDcu z(Oq+i1zg8YjD({NVSRhC0{RhF^V%8Eh@7C5Gb}<>9ji@Pg;wyHhRo0&OR-Ok)~nKD zFyk2uH@^&D`Y+J!Ub>zC1Qo5z7H7?o6GyQNJ<&{hB$p?97|rIaF20!U*kLv3i9898 z(l5D%b9GmipPh`(vN)@eUV+|qF*`aEIk=k+pL?@;*|k_;P1*BY?2r0*STADt>{CAo z?xv4#9P~9ccrvn2pdZDKzG{=ksjS-PYgYYi%PJks4wv#Zg!R&I*n+VP3VS{`cvfzthgHHH zHoybcr@zBXUxRkb6SZl;YF&_1f3H0)_cpxs$nd`B0{3=y)`ybN<6=o|F7V)M6hs;e1k(7?G0GH-e&;wQ?BagQZv_= z>kjKb>%vp54CYUxDQeexabl%wJ-YSyUEXiKWn*||-rL8-J-3UF6p#<^U6gY>>((Dn zWmzH&6ViS}+}7haJ(6spw}^`!ON?S(`W?EeJS1?(ZtU%- zz_X_yokl~Ko~Ln~ax;KScv1;tE#;d3;&r{AsK?UuCBAOwc^l!&M`ByA2~^abnMj-V zceM+a9&|hO%C#CJf$fIpEcAyPZ5RjV(?ii0I?!uqHgJ9RI95Qc$SY>Q)nFC0Y^~nr zXyo$Jp1BJxp`Q+{kJ4W6zMP^JcgtfO+F@-Oks7AHY$?XtkJr*AwlsMGK7BWw@1^wY zv=KdAX5y2$3$69U;C(rkQ#^$gP=-z7n)TSYZIe6FhUr!5b|~~Sx`;NQKi6=qpc?SM zoA5nZf5>xj4TVyxNTNTCZE zV}gIJJRbCC=ykd)I}Ry&eKsCX+aUDG;Zy~A1PY(bmz}V>b2rbRI${%^(TWw4-t6u^ z933)n)stI@r8b6-596Ng((Cbx^<+PqK&ADGo8{q) zyd;cL?o$-T*AWV`-jcp2^VrpiyD(1edb8U{GZ!PJi;&%)Vh3H%PMws#4)=T*i|Qa1 z+biLhUCoRJvLnS@XAEE<>o$+mpj1DOmD3ky#}w;F4C4Mnx$CKLrHaW)IMNNsp=rpK z?&;>V2lUhnFX-)@#aUr@{B$p_9?rVTt>l_|qx2<3-=ckqC-SZ~!3;*M2frKKQAC&VyJ1J(Cyc6q=9kd>Q<1 z5cJdniW-kTcO`QAuB0uB4QCEG9IZ^ z75Pzz9k-gO9g5tGR!~}ZzI(Gztyn8PHri9sTVSp1Xk+PR)6b)oBTB@4cx&mBd(WEd zt&;NPl*T&shd1U*J!|=_)pBU@E9BrNPU%WK39sO@J{n0kld;~0mUbe%aTwz;hTETU zkNbOn^)J{Ps5|sCAaLh_yfPDu^?XkLRxl-Zr&X|F-asaOjNRRklRb?1{*Bzz=$U6l zKYSshXb64S8P(OO&i~Dst5Ifoe^tJlvLbelFo(*_WjbZ?p4oDCld?~Y^3-lITATJV zHooTmPvo}&+`+yEdI;@2q4jI+U3;q<0gZL~8*sN;ydHCg?69j((x|tdH2r+mD)%by zVx848j6IL}7eG<{IJ;^pc6e$YW>Ax{6mm_BQ8<%MtmCQpzz?7Z5gjRRS|SC7mj}{n)B5;&*K3)CV2v6(#3d`4zRY%(I78M+JRkK z3r8Bx7{wCkd$TWsJ>)@mfg{sSk$wsop}LAF3FA;kT8dZD*GVsYCCL*gf-!T{$^J^yS!3R-ejX=F)@NSSd!_oHz!b zDUQxaU-aPA3wE@X2koaM4p01{wg0T`YR^YC$X?9NUSN8E$3cfmPPJFHQ)?vDU{?BT zbD5vsKRI1rR(T*}nZo=YqC-mWqOL(bVq7y5G&!%hEJ?G|30wbURXX zA$-P_FuH!qj_fiqqjT=6$(+_Y?3?L#R}=q-H}T6`KJU2~a_^XR}`e4>aYJzwVc%Ww4rG~zi4Pn07lotv>H z3y=lhvFcY4*R6&>{b;<4_ah0aa@VWb^^vSc4@N2{aUN#$t0~*HRHUuXP{&XQE{0C5 zPhce1XSNKV5OZvY6{F#G_)Xbww8!d2dQ19n{vxJJ^r0w8>9lR&6l$8sLbD=BZ>ElQ zK2eLUX>T;u|8eSWg$o>D4H^?+SkE4twJp+8G>$rl{c7t$`(n_VA<>NImU8x`PMCOHak8`B2gt9r&tnPNs1VjU4HlQ6`LrUZyh70r1auP*mh) zy?BQ5()GNSD1Hs>{I|fjt-ynHG8WZ-th0P713iqsIy-Qle&Kvu_oO9j;^~$DD-F~t zv@1RD#yi!J>@TaXBu(XnJ*>w6R#d1(cClU3^@!Jks;p9A9bfCvlYsy^s;oN%Y8S9tysOp~z3YymCf6J9P$yPm%N?ye6e~!G zwyqNP-hQ%m`Hdbxd`b^QF@g>&B8Ze;?(AQsQOs9iLd|~jDY%eMpv-R~Nxwflw;Z1S{X{E= zz^hj#EugGh@Dj+6`mkzUnOjFj8>vSdz%|p)XCK|pP-#BT?aS%D3SVbcxb-`XaRtx2 zj2P%q__ik{)u|Z59GAXI zgt`*5d=_3;A#`+`%{U*%$1xoq|1(|;^~=#*cSh0Oe=2Uh!}bRqGSig@FvCKaf6aw8Nwf*sQH zBc{hVgHbBGD%kHWc3vOCst#tICbJ^rkl^Q18SDolPdCD=sw3%7;JZFFwJ@nem7@Eh z*QwC-(OmCY^b{3x*N&Vb^`+*}MIJkp&oiyJrB;{^l}|x4e}RtmgWx3_;92Ftx_yOz zem?mEd1&5w$iYXjy%%HSznI>K$E_Rw%S*vx55NO^9{i|Ux*Xi~L7Y3)jOu zj>R~9#At|K(CBG5LyNeyDj(_M@PMi2>k*uP#MQPf-L>)ZxOJ`$^ z8plS?3v~soSL3TnWviXUXk0=fn7|0W;F~9W!yXW~CxEC_7zS=_Nj+6ZA75iMdcBVXGKLudrYxP6ok&AEsAj(7kO=ff$TY*efSM|HjIp(D*V0%dwn3Wi=}ueeglDb4Ls~U z{D+r<1K$M~s6lk?S}1)wGdGHBZK3hZU;cLw9Iy)Kd?Q-^ZCNEekFAJKzXWH^uuo4x zN}dQ0_!jy&8*TeCICT#+mTQwPIX_^RS)WHgpAth<_%Jxp6rOZu&a1@9iiqXzOk0A! zx((iO5&q1BU`$q`k@rRVT@J_J!wmYv0lOvNaXQB(wXq)VK({iQRKVQxSQoje=fqfu z{8hAzJ^RE}7O{Ks0re2^VV(`Et=W~(T{PO<8>(LjeQYA)GMnhc=kUjdtlMw!_@zmG zxPbXW*3&U!D9_R3qR++Wibb>XjMS*@ByB<^j7MBT)O6Z#vP6gI>+a8J#I)*TlV5up zYV)3%8KRfWL>8O(Zp@*mFeBu?=q@bW=u#*d?Em9Ps# z>DF~8IzaaQ_2JFyHrLCb@Xs%E#1NOGu9wic~x7*wMTXC+g; zpK8F9WO;$=O86Lw*8KDy{h=#rh2a>VJ@^3<8gp3dA$ zT(EK=X0}Y_st3^>dvY>&gZG-7UWnIg6_KkNuFT- zC%VNtPWOq7`*l3?9YBE|4eDVFlsY^qgU)#)TFZ23K>ufB=01S$4p4?Pr;k_kmtCf7 zumkpAs7n5&b?@w3rA?q$)~bB@K_2M^R;t*&Q_fw9nP^+dcib1d!dvIb>X$~PMJd_; zN*Siyl6T1kt6>q8Wi`ca%G0C*C7Cri^%q;qQLnHopUY_Hpgq1rM86}N*VX86H)6Ri zO4@G^m;*T5BCrZZw4PQs1JN9ay9(AO#; zRn|gNDL%V(*okJFwdH(<9I~&x0@O0q?@zcV+)XPS@ud%6sowmH+K}V@DNb zXsG(gy4fkgr|CNuBRUYeHnuN*KU)6Pc~`!sPEw6KsawQc;iI5xIhZ`m>eMY+Gh=gh zA>V{fH4Bf&`^cQCc!*!+gv=p#=52J?xtvN-YWhxkGdJ~wL0s7ntws;AxMg)ZYmDi0 zP^S8H^M|#YjGHv!lcE^)pSED#Dl%I+vgmcWqa!mzK@6~~+X%kUm=%qA3+*^1{g6eg z!F(S{B;amPMir2aMZ`XLqW{fKDudy?0&ng}M%bQfyYSVCzq)g(26LM9KeUIUv~;bz z>)DA_X03RpMXlwO$C{dlrj{mRO&qxK66J?HOwX#LlQPw4_2+m7&9b(-a@;@fZudpc zh<&8(J*2fRmy|v|x!zfdHPb+}fsvOJ@isn8c25Jexcig0lJC%azDBdZ0kma#;==2Z zd}A10d)6g#QN2ofqU5~Q;R!~1Vji~{aC)EYl`;wHzZWEHA%5kR*a?sDa|tr09@6s8 zpfmSpwdBLDbv533uj5Rfk*&oj<55Q#$IU&y^ z-*Z)yv^E@eD>T_J(L%cp4m}l$lk!B@nU&Iwd-P^J#jJ^$OV;Z1OcX;cL%I7xwBnax z9)0i`zQtO8kIdT{Y|OS~;k<;^eVhr6(!j}AP$G3lBFE=3?`vTNkj65hI z4!ei_n4h%7Uc48sFq8Grs_h&!doywM9e6jrMY+(7F)}@gdUE6iR(p5k_A%EYGZ#xw zcSC-QGQrIM23#YR+gDbslr;m4;mP~y%D^Y(va$Z3^=+-SswN=brjV!0C)B)FGQWLz zcE%;w;Y-d*%i~4c4ZpYy&qWSr@LD{)^WeI}xGwfZ5c#clJH|ka4z}m6p0zy2DK9F| z*;E@eGU15KfHjJyyTLEsR&vLB+48Fzd^+xc5rxAUfj%*{0?)U(6=Doe=X||Nq^u?}n30_6 zamdA9_)P2a)r!5H#aZ5*{DI%N1}l0vSnyl;Tm@wOdgyurYiN~h<1S**)HK{Z<4Ss? zn=|G-{#W)mW}`IvmK#Bp)|0QoPwjB4;aj&-Y0!mvi^37{--1y`bhKzGeJ6TT?U|vM zz{p8+W~qjg%Y2Q4=wa!=Dv!lSb1xXB7U;%TfKJ!}wf>16^*q$Ej1xQ(t>psF?)zYb z>!)47+58R{dla2{8vd)3;ARhlT=)i0(YO5nAfFwTWOUxSg=pLY=%xqbD_}lKZzW%C zo^8*)y6luP+!%uqZnYb;=VH858`3p#{8GmdsPS~-BD=t79s{+lga1DdSG^5t=nKc( zh;?=$Tt%8Kb`32msjVVJl^h?n4OztVXtOtx$yDMFAAbAw` z#E#-8>46r$m(}DaKR2h%%}SqOeUFkkeVFW{s$}wAlgJ($ZmXDoDl3f~;1`jWcO$q^+Az$Ur(>7qv8%LiDXnEqICng+Mi&TWdaFeH9j8 zE%2uacv1>{&;&4Hg{rdDsaG{}%3Q6?GgUEuJ-*s^i7mF^1a1HuH<-m(^{q{exX3N= z-hSY_?4n{|p}bWYfu;O!`GBQn3@DQAJFwRVKU8^odu%I})0NQ-9>W^^&b({h0tz=m z83B1G+rgm;yt6qwt;lJ}qL#)kjjjmzEz3$i!|LEsJ$R^m5dXj-E!6&YU zbDm4>%R^|{bFnj9v)}XBwQBNIpOv3=s(L~_lvQg{g?DrY&b@i|YV4#>h^4lLtKSMu z9N~`3+5LqkBfju^(Im#>{ZjpUc_@M2|J+5rVdOiL_O3O{4A{V09Mz^bsLx2%;-Vqq6+;6+5ch6YVJLM)X&d@3L7G?^4$q z#RO$H%OaCsO!kjFpNg_6H%7X!a(I+c&=jaB_huq;;Vx>v(o)|w1TOUu)U}W7+8$52Tnbm_emF0UYfXzvVl~Ytk{Ke7L_3;PwHT__nQ+EI|~_BmxD70-~(UapE-ym z8vs^+k3GGfNUx@JcYwlG3*QH=Xc~XrL%w8fIN<|mZXcpOJ&B~f9u0327(54W#6!ek zv*Bwm&sPpGdo_PAiC*9Q*;bzQxebxqNv!jIPJAu*T|_1S2KdSmJih;eL%+&C=EI>2;J11loSO#E zk}tG1m%91PB}#CR%$I_|Y$DwB26+FK@be2zwuFXuE%6RzTuWltgx9DtR9+|LhRJqT z98eKf#W^)!M!b0smPa0B^B^E_E!?I%I9`OP^Imk!DGC3hbZFf}cC_#y;7-!cm3u31 zuBumZfe*@-@V-^yye5Gtb}Oq``g;f_>Q(tQq}j<{QSO!O2URC(#+T~R)rst_DDTTIn1^D?Mcp+@rXYM9SlnZXSk&1`mtV>m|sudFab0p|p z9%yxy5~r1>BF!uhTvnBLJ~KBja2E$rc8*{#{Y0~4b(ZREo(2A)ZdA(Q7DY?u%D*U% zAe<#PW~B>Ws0dNcTAdyqE*T-QpX-uiz}C2TtV4U)uEC0 zSXZFT`#?l~qMQMS7|PsIe4=c>#sJzY_gwEV7|6Z!bPS0^v$ zC4ZoNZ_4eGR;q3=;^Z|sElGuWaOy*xS0!*@9MpUR+T%1L6J_8(@9^4G_(X3`OWk;s zg`jEklgadc4(Z;26|R6k9K*&s43}7f#$UrEp)0LJ2kQ%kDqgS8N!s@Ya?6PXe?fLm zKc0i{4VnHJ+~W>7#^reHCh~JFeC0W?@Gbb@oe6s(AJSwGTtito%AY9;EY;sbR=j)$ zqFm{g(!r(8%ip4!y?mUsd@0gpMe~w2%9#?cSHCjVv&)iE-i|U>6)6{wkRB{8T>6zV z?c`DEioCl4e)b6xz8idIGEiE>`WACCQ}})}zu!khFu;G66OaB0xZrwppHe0OhKr$Z zO+;gS&zI95jmVK(HM+eifhD z0;hNvuUl92zpds&Dq?eCi`BpvZ~}ek1>!r;aiTkk?H-1P4`8F;mhhQ2#Pjq#5@;?| zFot`nN6EB=cjORp(W*!;Sz_ye#@*~-HT#&#Zid5YZh;%@Lr!c>=yNl%Tgng7iIm)8WP`E2PF9o=d+_%s5#FKT{Z)o+95+LnvB#SXs^mh zz6d_5i~;3;tF}Yb=d)@R12_w=qDz@%eqP*8vQ0ju{-iQKl150U@@Pfxv?qhR z@>ePPPz20Sj}EOWE8k0TZ&d-G120jAr zt{PpRDXC0bY3l0TR0>I??lLvlZGE0pn4i+@z+a4#Cg zJSeiasS4kFg*e1AI8!gUWE<9}IbPMl=i01PolaD5C7*&Msj@Sq>&c^`T2fJ$&OsCU zrt^n&5a%gMJTe62FO=~tMp?H@`SYpM`DRyc*}rBXXJgO#Hpz}ieQ$3 zpW?Aa`4YB>dd~vJif+qip&SwU&t->6B1q#_tWb8iaz>PEqkIDCfs$sDK$1aPU-c^B+@ziD&!)Z ztj_il?l+&^zJN`i1*&bxF6$6iENtR%cjzL_i%2Rux0v!A*-RfTd?@1L5Jm`ha=R^EP_%m21_(oLpemM>MnpcLfs;ik(!?G z>X9a|yz&5N!QCH<9YtHn&HC~}(`T8q@Zcwa!6NWPafAA-NFD(B)fGXNCRGHODdyyR zUP!u0!pqthR>-rUh=w?>BK+zAra5);i>P0vB&XsJitZXT{}}I8ww3&x@-)fPEYJUy z-6UH_T7YZ?MLm>{EbCq#QfYGXIjH(s(Fa90lKE1p0*GuksAbOHhg5{T$&76S~?+=xjaq>=*P8D~(hx1%6aEX|YLPf!-Hk zgIop<)#bz#_Y}seNyel3cuemTj zEw5?i$`4V@K>jdgRO)9r?xlQ!9KcV#RwN&bLLHi)Jpg-t1M3qu*9PypVgo9trJ_lX zMt=;vxrsH)hS3yc`3l8})WNPUC#86OZoUhys$I~GG-*@v#ET!QR#F)!su-!sXH}K2 zdKhJp4?^`Cu}l0#hpmN4alI;oM%Pg_5l=dE7EopG&%)a=ek5@l!4kB zvdTeF$}B!{HG1*ocz0$ai?2n}Ek(M|;~I!GPzK9KR6}2XG77I4hOA0ysfw2?Mv;lt zd%vDKsyg5#oba(Ueb2z_vSVc_WZ^Z%qeFJ6cPTSlv4MbBbE3man^Q)yj|mk80?LVB8u9nwL&rbq!iW|x@k#3{tm`+K)xq^I3HKUc0DmB5l(r7g5R#Y8~ zYY0bG*UxEO+hRwtZOak^?S@UZ2ySvCuw2j2`_a)hqO0veQ!r@spQ7;{K{MEnw($UV z!xLy6cfxsA0Qr{SZ7MRUcO#u<0kh5t?N6Pl)P+;^fZ}UaSwnYlXC(4<3mU}-WDT5; zzjY?hT$a#0HuKzt+;0hAlX(6O=vlLoNaHx!2Brj*x|dJhj#fDsZCJiy*&*uoS(>Lv z|0@Orl+UR=bjc+}i^T7hW0I(P-~{AT$jEyYH_FDR)TKmmv`+BW+1&jhctm>iv^v0~ z8$7l%c1;tLgUI}o_+S>Ixu|EPq_5>&q#S00oixzb)Ft?L4*_UPvmku)2~-9Lf+sD!`19=yIRGA=V(<}Rpa z3f_i`p*2OktFv-NoFp;iyOzeROd(~4$U^Obl$j5m-H)_BhA-p`Xy!}4o`e2YA-hLG z|DD0ViacML-OAfkR&)VYBhOa@F!Ew3dK7or1UxzKUgg*!Qgxj?%sGE8SD-<_|T6#mOEEuV$=NGoct zeM^ptJ|r&`XH)KhzLa4nOGw?f6faRcTNUgL*iSjAMBRhO0)b^v%A2vb=<0DUSkw+0 zZ9%M}0J`I+NUojuKqo^{%C6DuV|9ip#*?MpmjhC=rq!FXKku54#k3#H`IbDB0z@5i znM~07w`e4if1{vs^3U4`6#8{Ez422df0$bw(Ntf)=IgUB%aMPG%1JcQ@?tHo#dknqS45U4=JeD0gTG zZcDdSy}NQni|}l%LKUc0pj%Z$E3!0={jEc1+r_h<=JVU3@eSN%8gxDc$tE9*tOI$5 z6|EK*7f)AyxuWqI*|juW@qJ;gVj0Q;k*`W{5J&Sq)zo}Go_LS)LNr}XS%AVw)pRvR zBOJo6r$e*5pxBSV#3U1PT5qC-K23b$R&4*FK)WR?ugNathZD7(12)N*shFp-`lX$T zZp7K7_o(-{@(Yx2pomun-XW`7@{NgvoRaWOUC(9xi08`Js!8c=N7ofhh%P_ z#aU!G8L;Y(gF)-S{YhA2jaiNQC`d;*n{`NIS2drov?TYG4l2yhX((v+1m&$D0&)xTX9@cB_53!QzeumX1_{uE=v!W5 zBd@~~?t~l7;zXBmhjpy+9dzdMaELDGA|uc(mLkn$(_h2?ufozF!(T`6y)Ag19h^Rb z7hpO2ng9kiV>QyKR5`6as>(&vj6&h(Xz=5@gw1daOFuiZvH;$olAPCM2pTG$>KAx{h3mM488$HAnJsILmf)s14wu`i74NM_VQERVOR` zUb?n;g(6yop?vW+pL-z9TD-0VPi)AlyMa;jfysSv{g27zN@r3fDE9;QxgSU^OZYAN zA_>$bvjJ;Wd_onWia#oTBzlo$Dk}AL66%R@0e9{W1g3Fs_2Nv0oqi6Su`wL;V&FNH z6B`F~C!xEIz>jndTHHL&ZaQD`2VcpnSMaWSP;U(+Yg*)p?5u^{aWp(fen7>B<&Tqw zBA=Y-L@QEOiE3$;r{#5d#q%WrGxEA{PMWYX5@hYmD=g`+4*t?7Ei}4X}#D;heT*-}`l8>Z0Qlc_YOTtHd08COgz%V3)vQ#yzzB+eO z{)V!7bWfe;VBRwWuKN$<@kdDCuc65T;9mMfXZ*w9{2FZEHTdSP2Yc>7CT&AXehSsr zfkw`QQ+9@H_Jg7Z;h*lsZUd`0|DQEb^r@)as8S~=dbGNlQr z3!FIV#poj=z@~fI|J$**p~}zj*`y*md=xyp5ALpx@!jBE{eW?cgza7jm`kr$2WHhw zjp7|MSj|q({T(ctY@AhP&a5rGq%G2?54bx89wH7RUNQ#ma(TjLQDnC-uQviBxq#{y z++ioQwgBCw6Wm0WgLtAm_tFBCkEuS|@&hY+uO77x_}-9psHfn?2?*T=T=yZ*GqR4n zP|bP3y<>tmUJ0Fz$7Z?-tLY~6^%YRrO#D(~p}TR!UV3xxWjMVw=r=on^IW7%A9kpC zhPwPT<+-(4kMzl?@=6|8FUys6s{S6$IM3eT-#Bn$J(wj4^$qxUHaJijF5L>>=3pp$ z7QA^bTy_C`dJU^u%+D#TWf)gaU{ZnACjrsD@VL!rmMb}rE%3`1(VtGR%Cq6bf^t{( zHV&9hJb{e( zAoee0elB#{`tYo-JgEz`Ul$HglkArq<}9Sihrn?ov@1`DI+1ljR!Ku?1ZFjcZ^_55 z2>%eY((BM+$h*gb`U;%pMQHOd=e32rm}?R^ss1GLWJ!~epG|hPe3jBI)hW0!>l+A{ zoX)8&#`|>x=X@(?xEP!s&lA+$pe`q=__p$xRplqSArFeQ8_hnE&Y@GQ&+b)mttuEz z_ML&(WF>aRBXHMk$l$F=;XCkVTnn%04~D2SP(3~?ZA-Wy|C4-5n#-cRFm=3FMwYr` zq~}TM&M2R>s9HH@%7bsh>Id>1MH@DA?t6j30kHN6KktQOD>^$1Dw9`Nl_TnwD_d3> z6dm}aX1vb?T6cphAD9qn6e5pOn>e`t8F;sed(7t?MsViJK|3$8SNSR{BR|xcst>PT z55L`ww)6#+3KgK8YG7$g&bJHH)E&xenYbE)!$sidN4f7dbg2bgbMe{C0qU9&{~)~N zI4AjeLZkSIJ-h{C=PU=qyEKzRej#gm?nTlWx)2$; z5?3A{20d>;$8kKnf+cqdx0gBn3RAAaB35<9SrxE z9IXupRW7dL0FuS3dQpb+Y$#&`r!0&3U+8Z6pqg^fYGdwH4Y^hk3oaj=D7`Vz0g zsJMu7(G+Qw-Rr$k(%zH_E5EEhscb~~FVgY1w7gIEQ2v@U9%Z_z5<>GHdVu|Nz||F; z(+)Jdy{u?Aoc?Yk-8}Rc^)77>Wk{ovmsqg}*K0J#l~BdCGifWF|7dBWJA)Re2JXldo8G4NgK; zk`sW;4A%DqpZO3g^mVS!IfLWyfG0SQ^*rS&{0++US8q6V4^fYw9?<3#c6TT5dJ$gk zkbuSDKj*_kt8((GkZYfwg#H57&TmqaYFU8Fno%r4c9N=QR3TpzY*T-sIlyNM{2Pv)eZOJ z45onpxA2^u+~a$+zI@2zlBW8}6?R6N)`ue7p($!AQ)~WT6HTKqT*g9U`=OgP2|hKR zv+fF2DH}j}>GIe}Czn30$dCN}^0_GPB5hsy3G#i)0!_vHe6^^m0u&J}#T}H>b|I%F zE;k#UdIc1d#JMI7z zQ+S5&_wx6}tZO7R*oIZA4`5a3pdgs9lTb#ld>xAZC@VwURet$6ugSxfgOgDf zLRLPZ7^7mwjT636P4t=%q*nps4bb*FG}T-9-;H3>mGGGXP?Yo)KQBc7ZgoNFjGVp_ zOk9L+atHiCC$=f^eH$3Fgx3awHCn4qT>b_10g#rUK2Mr`&=y`Ie!dV3Xe#n_4qq$y z+z9w%2R_*h{8itTM%+WQmsEK^6}@3J&$|uW*bB~V2UiY*6T4XNEqrbg7(R+Sx8c1l zSi7=NI+gjHP#o!0@PiYTkTN<2}Kb49My ze?c5anaHZSRnM7boZ6*8XeMjAi+k-sm;4xBof&UrB{*Sor1y}7ZPE)VJ{)bfd%~`4 z0Hw(${sLa}CFi?^9j!v9&jWJv(2gYIZUvgRv#V|3^>T1=Ie%Tk8Og%h2&J!OC*tuR zpckFMn_ChedJVil<=|quO(wYKdq}w#kYmf?yq6i?mbyW%VI2xg|P`#YYbm1%c*S(o9tsS-~&{7s#;6suA6 zM7FoOa5V>yI)g*Kz#(}o$MEcHxW=Mej!M|Ly;xUm;Hjz;)qOSvYZbNc4?c`d@U69+ z)J|yk9x!bS{A)AUS~%6ye7yu7euXFgU+}4{NT*`R(DTvGs$dh<{lie#W_=hfvS3wu%hw5UEw7qck80s5&lubsJ(U-OE3 zlBwfiD$ZZi9`zYTXmv6=QRO4ZT9;?DA{3!MfIYx;O`f|R4z>->_By`EkBCwkqM$Lp z$4o{vp7-$c?12|-h9|7S5|YI-oA0xL$Te{L*<91$HuHdyc*H(IkAe{m&z>3;6Fl5?L74;%~k)I2TKMk+H<8dwfA0!700rLMlpI#5p*P1);- zuB>T+Q(230m~Q4vk)e@Lgy>iDU3^J7vx-2-Q!Jmga8ywA(Nfj#doGX**acueo!o(J zjA}004)ODQ{vM-$iY9WZE-?u>%TiM1ka9GuAt^3^279t|b#9*wRgUHA3y)Hcl=@Oh zpKHpRFJX_eCZ);D0p{|ot!L${5?Z~ik1N>2P~O*`J1UCRn5zxHOH=O6-qbx*p4F@2 z7t4U9W--bplb$$`_i0|7`e8QZ`E3(=#T8)o1SI}EAiaPmuH<*|+fl6VQr<7iR5?5) zfP->Z)VWCf0%}Td2L~LON6X$beg7?UPrv1_)V=XtnJ_V44S;ECCY*j1OG^#Cpr#y* z062@!i28kPT|VTKdID;Kk!A#SL2I3m*vnFIe>Qu$Hi19AfLllQqI`74g_Lhp7HE{_ zlbSOotnCGiMz9NYu@fdJKBc=V5~1#inxZBDoTTqHz-cxs{k4A$!+n3o1)cr$-(qky z`QIdX+a#=XU2o_@F2#rYVlV2No4D>u#1S4KM*aYm$h*nr)AgAyI&JF8 zlemgft5K91WL*ssS4TRbbhJGZ*J%0|jb?hFu9@`WUBJ`_U3Vm|hw0DqFuj;`?csVU zaeYW{nh)vG!sSqWxY8xA9CRMY;R+9!gwWn9cKmyPtP& zX2Q)Tw~*ZY>&QEMeV6_tj5DhoZk4^g>+&(P{^x9qU@kbpxIcT@NR&-S~xf z<73kGX5#vUiiS_{g>zxyry_cll`9XHn{2n@e3egJHSr|Y#BS5oJaM%rzp5Qtn$P6x zL(Ft=;u?*oe>CwjT~ia+EaCyGi=EH4lwUQd7VFhJ-cT|Pu_`s^Du~h{u)FCJ%9P%lHuv$>Y=Q6B*Q!Tw}1TTuhIW?LQkFi zihhsI?U#P)WTW%-Ka;;lujwzpc0GOa9r_u4MV}ESMSqR3>gRqwlfXIu{b?{!U#EWw zi#2&Z<vjF^d4azB>!*K-UirD72Tp!UKRxG(eoOv;^!Ecl@E`G^=TH7mKTrP> z7yI=~{LWu5oaB8e{};WM{4?T_5x4X|fByTS1V`0t`pt9M)A{~Vf+y?yzrPOi`r*VC z{q+C)x$iG0-WPp;+5Fsf zc<1ZX7yrBK=*d@)QYZLZu4BCW*l)Ow(*;7;v6DZe|DXEv4QiK<^L6^yoAmh6yY=(u zueVPAT|eLY`3tY&nd=M$&OqP{1kOO<3wRY@%3?Kd{S~Wb}$V#|?Gcf($|DU`22wOc$03Yjc$eGX`%2n}Tsc z{UEJ-kr{+jTp!np>GL(1bX=LMimU3X@xNM3D6H?AFj2B4ueWr~_+M35+~su6enh^~ zE~aVR&XaDiH`-P9Zo8ccQSUHCJ3X@tm8*2NOV1R?x5#d~pLb1TzD7Idxr>$V;pF8eVvqOC2@ z&Ua8hT#Y>7hsbH`LDt&2WWQ<-ud;5FW1}f!ng1KV10J&fEZ=nnvErfRy*^CF>vv>!XEl!6m-~qtwFZq?MYZDPyMgh$)67!-BIxIXQ=bg|CDvFep%|AQw<2Tv8~+LU~bqloE8=j znz`a^FFP5*O=6R&DSQdcm=&Z2Zcn>BwvOpThG=uLpVh}$&{1BuFiL&SLRMT)>Uw~x(%+aT|>kv z4>`$|6S=yoH_==YPi?|pk6p>MJUe3H^>4OYi&}?VHTzn@Gf|615bw zOh#MBy%|20bXlq{sd^_(4^IT8c(pD$%^hQ_$&~+=DS^Go{aEfwLHBE^q8PwwoI^cMcW6=JIFRmh*>$inOKc)aCXW z<_6BQsZ3AmOa@YOd4MT}cewk4Nx^f$V)u%D#T=lc#sD(!JyvSYhwmpB@G~2k*-Oaa ze*nqxr2UL3ldZ_*aOCuMirs0Z+D*Y(;YIN*@xtMhpqsO17c!)EqW(esMKn7p1UFR2 z<98!C|F!>wm4330ul&%gJ@qxxgxkWg0p@I5(X9%L#4m~;i7yRr2#VO1;NCKL7f3Qm8RCtCt-N*&pO%(%LxjNAamjzAnjo-WS?)$l#mNJ^$@I2ggsGESq|TlC|Qj6d!Wrn&1l=w6(v{hId_#kKwtk#?6f9O zP(N{1v}uBj;|x`Up)QD;5OZN{CAFbTnSF9G8hL3l&x%ry(>r#9>1LM(dBY{~o8xc9 zJB9h&ben_f{JF8uY!-KIST#N)sYLvP@SUJ9E0_%aR{&E~C#?=i;%UDP654m9w@6#` zeF#)zroL38V*fI0ZGUH7BUivKgGx$Ky;6%4%FOQ6J5&9tG+jwOax|^zA#=0cA5;iC zgMpZ4n+K6l!=c=_&D*YOaBH|DUN<}urgQh&i%eB&fHb>A-QRSM(p@8Z z)Qr4SpPX_P(eIukc?y!=DjE|v(#)J1RL;C)>XK3T0FtMtiNUK|0SCSA>5!_h6rV}M zxiQcDS`4SIZBjzN5w+^ls?|9*4ZDzTb~P9`o2ejE zupY-SX|fwNoFm~To$bn?TDT|vVN&Dx_V6nA64Jf^HB=kS1be&tJ}ezRAMSx#K0{`X zqY|(h_~JWks1Kfag5x>G(Yd}(V04JhTF!1{!a;4gXFcBSPgX1O+J<&f6m9xbbC;dw z8oK+q>e^vu0hOPVnT2vcGG}47 z&3ft)TY>kQ>ZM5`(yp~0)n!&iBTH-6F|})h-Ob$5G^Q`yuqS+963FA4B$tP22C#WR z>btK_V45T^x`?E$)~7DG>MxJxe>8lR0a>Ho6tFvq=Y51YMkrc0r1^~IFV={v~^KC%P;3izDL%{6CLy@Q!gN zTCsWbrCV+b!@)+{;&9@u?5YmXmPR6dFS2GObA%J({E{u|;wv7Zen#22&n@OcTht|y z@BY49$HVfPhRD|%yr!8?s(jACC;j<(%+mkFfz_|q>pqeS*V6fAJ#gMmz1|L6&n%)J z$N1PJQ^>Y=uZ82|Ym+j^7lqxBjSaE)`aof-ij^hcXALGH$w%_;BCcmJCu|dr2;Ok} z?X_koHL8_au{sl|UvcKdY9ia}bfj6zvrPHB&edO{AqRxS1y#G9o>g@Kx3kho=Loji zC-l)OK)vjs*j;9!OA4NeU!Alr>D{Dq;YN6JHHww50FG^K73vUQ2@1J)TtnL%jcqqQ z0Mtc6*dxB;?H<)aPc$v;f}ni3KglKaiysRYyI1kXWTTdOlNo2PaT|iA5a-iy9Yc>| z2c@a|uevj-$FDjucuQOs>0ja5lU*J01#t;YCe>8wGOVLijCo6Tb0U4wihPgChVDrDYtReC z_ti067M41VB;UoPK#vF`)SX>=L>#!Qhq|W0=BG#0W9C_RVVE(#BI&xM`SIJstgfZm zL!XzSv5n>;rVBme8o16bogIuf;a_NEUBRadnQeF2b#)_MUOUpPp_|80a9Z;SB_q{M zKolxk^PDK2Hg zkNWXxc1(F7t?G8^;F2WC+T5SK(BE)7&ut?p(yai#;q?$rLTbh7^=Dr4o9-gl9)4BJ zjD%L(LSKHmygI(7<{VDF%Wru64{y~SB43N7M-s4A&yQkIN-n(9JIzY_nENJpH*6ey z8DzFEo6TrK%~*;0XX|D-iar%QoB^vH?3fiReVCzqe^oXOz_#rYWQnTRG6N;cFh3yy0_%Y zxmY(Z6W{rODdH1sJ2JkT;in%NyT>fFUk1zK=OkrJ$`P*>JnGIi_s}V&2Jlj+KFzMk zmVlCQ(bMj!5c}b1PV1MHGC~~(UE8bXuUJ2{z^EVUz@-Y=PgP`+y=mYXeL_SH` zandH$+qiga91)!Fs9}FOXcbg*H(6$m(J4;aq;cg9<#l6qP=ZOsX7e!WlBn#-!ves6{ zk2S}h$AqE0M5yWl5#hc33z6pL_v7#K7ccpT+nzwK}o2XgOtEDt!0* z+$8%9(;V|)7nWvs>U5%h`toz=6um4^mnfYKJv@HEj$7THSKgITnYL;nd!v~}q#km}7 zO|N>dhU~q_^2>}w9zk5;0<(oVhuNsB8BC?=WN30Fp2%@-Yp^%GG;AJR=eiTm%ZHb3 zwP|geyFS4M!9Bqwx7+T*8~ZjIi*!v*u=9LL_^9a5U!!wI*e-4@{80xeQG;Yc8T9La zV*eMl^NFgDqVGss`XF^;ebP7lr9SN*19RbLe9ByJm%F=zG1#U3+ycA;Bk7sc4!C@b z1Ziydp_#phujLt2h!|iiY}`X;3jT%niRf3dJ8cfr5lm{4;N^m__r^zjT^M{f9WS5a z6O-*=n-QPnCwP#`u~zx_bV-_ds!tEb4vBqk?yy5#2G`D&wRbRyxfC(rYP`dHuk{4) zr5NVH6G zGEMPOzj;5Y+(-2yUM3wt5mE7_+~C>@a#7}(FYuWZBi`7HzI;~@Qyp)L+mh~*U_ALH zHG);(U>7_vbHU}vGorag;+5*IRT9j6lT~K5)9rm=d0{ghjJg78aSwe;k`Z*tIP;L^H^N; z!q_W#klO@r#>>a|$8QK12U$4x3yH_}j@?K1%;)d}O($BEgWQxj+KuFtv! z$P-czPuxN>EZzuS2tIyIEoP2KmEc;gYazFv3;Azix@gYeKT7F&5_T@~8MHhvJB`fpvmjYZGn(0&&^#C&WN~$gO}5|+tFkKj;=NVxJ@Jk^o(rA7 z1mD_CjzU51GL~5X9J~qQG(I*UUK8bQWJ0sLl3sZCV7;9n4=u1)(4`?Avb=0UT1Zop zr~k)1IR)_li+>eO=`!pgWfV&IQw!Vn2))YIkmvUv(`DVzQESWrMq}CyqJIZ46e0nS;YYCi{_jmW-&5yj#=T3jM&f zygnQGg0wPewDK~mfA3lF(fds+=BD0CR@L`*893IMIB8Q>sxFv%UnV}G-6TiTB!L6Y zT6kDEA#KVa$!p_9Y#THP9t~EzuUO9^{OLV-)mwI&cqCm|(pMg-y2$5$(eZmf*8KjE{mJ*Zg)-WJaa!$fnltFE}fT;*qdEpV%O>H zmCQFyONYO5Nd9P_URsIrBH906j9mXGmL5qB@f&#;qKqx+7Wv?eJDAXL+;*|oCcHO; z$h#W|CMzl??M5AWr9X&wd5P*Jb28^r*W~&{*K^{TuSDj=5~9OTn+ikjPUZ67UibAEYm{Isa z=fFp=MXwk`SJ?slU3$LaG10DsXOVa4bPnrOD^L1^Vg{mM{p@ej+mLu*moRTwFL=Z~ zXeXKhiO7Pceaco$-tDQ{UYt8g+e;56DYiQ)_AVWF_Awzj&fLIObS@nZSJ$-ebcvJk zc_`jHlI(jC98z-+*%7ID-??~x_c1+S1F?nA>A!Okp1CW5y|{#I0qG6m>i%?-BWL0} zk!~yPvo(CD0XWhhyJ#7H%sY?{b57b7J`Uui!>MO-I`I7Idw#r@IPlO!8F?~uqRrf6 zMvy@}Gw2iSBBN)oec0Rubo#(u-Xl^q$Q5u`yU8xM?PqSnejSMRb2Xlj$L(Y~I@Wfn zIgzK#S**SacpxiCGeINS7V%%{xx)F7XM2vWuKsmn4-h|J_0pqNWJ^ zYd~y2TK*7nwx7q6T4d#^D?sPZwz1hv;@A${4w1RNhN#yFIy3bJ>*d|^@RvmP(P&w4 zmvUY`twkGtmiTiQ&MYV0J-gxUUuX{mO~M)R8u8*`=ODdZjwf&_Hn`@X_zV@%QRGYY zR>V)C`}hAvIFT%2y~gA18f9Fy!NM(t=5aPQZZS@#G5w)?0tabGf{OH{D6dnPP=#pU zQ8F;LnXj?WH}d}HIC=RfyhSVyqFgjdB7Lty7G)9hhP{WJgaxjTeSs{1^P$M*NZ+k^ znH>21h5e^pY`(>AdMJ^_sNTz(?Wf!@@rIPyPu@rB?UBsrmRFJw@~QpE?FwoIrQA|W zmn$YTbce5I24mzYP^?s(SJAmYZUOw#`9+lHH5u7WQ5-ilE2ta09vWDMb=ueVvRTQh zadeEW0eqtD2l?J5!^QPwtyd=>@O$#I&bDLVp%;;RdLI7oONbD@j)!P7x=goVI$6AU zbWB&Wt7@SoL>Uc=$8)vPnAh;NF=Nwbzu zK{>^q$4RHqS(sk}_ccd$LY$e z>4TcEt=O|{Q7_x1DS698GB_F58L&MDp{@6W>L(J@zS~|%_GKpWZ+hZ+Tw^~9dWWmx z&Er+VUO`5?!VIK;_!Yc=KDlER(5~)6zglP>#r_@-jC6Y5SEr|Wj-Czayn?9$Pms;K zp8I#h<5C{0r3w5r;yv;?MP5F6!p6itGBa&SyTbm1I+FtCD!TX%0pG>5B9Ec>DtHNc z`Y`R8K0u|BrB_Li$qlvP<&Jw)KNZZltYp1 z;giQpe*TQ`iE&u?3vETan!M)uP{J@enqQXSH&K44*Fy9?E&6h2{1au(2I!!u zaK^W|g+Y~|ll!MD0IaKXpYq_4_j^RX?v$Ked;77BZiA<(DUqx(cDvn3O~MwFi(HLb z+{e$oRQ-WsAzr?Ur$wG>@ifh1(&QV>fSX9>_q%pKy8B0NkE;p&jc00yvh?MDS5Alg z=E-<1udv63WGzOS`_w&rxVXuQlz2G5ly1K!(@Wc4!;B{^HqU~$y z(ivP+de7l|QGP0$C9;-%zOd*hnO`ZRZCdPWGu>viL(uVhFlYH|CV1;QjWNk*DS@+)3M|3v3ohs zG04gXspl$B?!YjxOMW^}`?B*ybGnOos^^g27WO%7qOOd5W;C(Vc4jBlJ!$C|cPSR^ zL^M_5LQ0)fpY$I5NZLt{N(UY)3raH^s&PJr$uyly)UGbsQX^Se68Dm~LEc7vSATVX zX%INI{zZ5inD149`j`JX2Rn=jtY>0=51Tm*0)K_(aVHQ(*WFx^z)QCAHT)E zIGvUKUwKaiA;HJvU8J!|f(#@&avqvpoOp^et4v`cBbUamG1YB9_g*+Ez9{}}{MvAU zd&BlIHLyxF;n;i1{A_kfcj?BzO_TL&(RbltN?J&dob3fIWFg)^pJ{)cOn~0f3GG>D z<+G6Flk=a9sM%*q`$(B|N^#Nb;N4oh)*stN_{-AZNzY9!$&>K%JiMB$I|_3o9fij~ zm5-idMEZ#8s4^wAPCcOjzL=M(G;3l1MIKLk`z{{#k!0)Y34W!D&nOne=Y!jqx@5xWCWU^YIx;B%kl>GdCoWG>1#`Y32X!Ml|Y}%NjHei-)7bvw~9g zQ?g@^!foZv_x|xLJY6t~dulQ6uX^R+hOt?U$93x**JRb zF5stWEI!7ToCBcM{1!bj<$nH(-+v6Fl-hqzbn5j~`yRDp(U6amqmx7&{3#++%BGL% zCUgqYyZ*23?Ds%R)GxgDH0L!i;k)wSb3(g|$l4xfUboqR#8#qE2aqoEtw`hZbP;K` z!b-&xd_-T~9!-)|&abkb7m%-+ z==+E8nC->pEdh2!){(RtKeb)niLdlAQ**hJc*~V&xr6a+tRP-q6&vk~ zpaqulRHEhU&|5Bnqo_(wQI*JBFaGzR(H;M;^G>G7l)8fCMn<%$F|osFmXD*!=OJfd zDlvhZ;98QV-ZLg^Oc|BROIE%=wc%#BOC4MqPLAgczY5E^kBBi0KuXm^e%(&C+%obJ zo7;=H-+iV!)!CPFwz7Y`MsaFB?oVa&FGD4g+L2x$&Di^z(qj|!!E3u3x^G3j+8gd_ zGM7FwMesFNJcaJP^(L+0m+1afEhf1NNt3VY;~995D&ITkqWmaRmh&>Tst4MWb{9os zA}uDF3;uLRk<8HUr73wyE?qwpTK!CBO0EThyX;r?IXniBn6t?wQD$B8`?P)^PgESb z2)fjIyq%L+*T-~5zJ{EiO-SORoT1*QOA$)_i=ORes5CCwcG103bHdGut*53Q^(A=p zSNN|RK!?K;nJ+$%PdwRsn8crbmgIftn=fMvzCeBWPP`~V1(-pi}w3r9UJN<#&Ah@i|5{#loVj z#G9`tA7KX`$AiR_57}O32iUpk_eEB(hk(znOV(<# zCZtgoq*5*F2YTaKToBw4Ru3Bm54%V04dgrSNO%jQ{H&Hmb~n26F}mh_@5&M_TEw&JfMuOI z&j(EpXqt)F-@A%AARmz*F4c&+`UhuAbpNW8QxB(Ns-}>=`?boS5fE z206*-NbS0kZ8#f_)Pa?GUZL(3g05esW_Y&e`HI1fLCg4v4nWn-QZmf0hGOaybI#>I&35JFf9?+vg}5giWL$Xj`kpa9r<*{Su0V=RmP@s znF15s790pB(ADD+vyEvbszLH`2e(c@kLcZnBB42S5ozZJ>I?A|` zT`X-Or9bPJxNKx0=x5}w(vy@AS{N()E__YvY$=*7lR~{L3J~gXff}@H=_}G+uTHcGR9ce!e;E);2 z4VF3`p3{yjlP*l^9fS{78ChPMi@H3|kma6@h}P)X^F-{Qr0#bhkf=bfoVxgDFUPZb zziC87YbQQ~+wtC>W5?nJPD310d3pYR@}?x;FAe8P9uboEDtuWbIl-7&VMhl!M(^=&La)->SHAiXqtl9TvC zkUt3BJo~cEz$=^4g7dH!zc=Y`KC?Fif9)Fkz#Mehf&t-m@v3;(X9vAqdh;9|zB=+W zRZysRf{)Yr6OC-#KM(4E-krS6O2!pcmqt;pEM!-$H0^9hH!s)~Zi$zRrw`i)Rmo_2 z99yeD+TZlpF>=(GGgsv~v)=T@Q~MwkRuveCBSx6vR~zvKuM_KU!ktKCNR2P8G4}l{ z^n{y67UcuxIwbvjaE4Y1`7G*=@GSb2rdOAMnl|EtpTzW#6X?bpO>4TYO$Wcu=KOvv zL$zDahm(DSk*2BIjY@F)(l)ir5F`a#Ll-<1^wW- zFv<7xYx(nV)7vs$Z_x^)JSOQbneh>gM{gX74}21F)ICJfvzW19%miq6Brk(-@Vp8KyJf%X0s_kHEbJJxze;G@1R4_F-#ja2tE(WQ{9w<6Of-l zIZcYs%bTe?`pBGg$|CH6PB>(5e#sQw7#%IE<0jbcmb z3v(-#WOvxtz~L*+7p51IWED}i@68h1j{1@H?mPD{w*nvhdEoaEWZ)RG3R~OM=pvon zT3$Kdt|G^yBDo7qfmWoeNgC>OqUR|RQ5LSf)#Rf`1_q!!b_0lz05BBNavDk^*U4O%2SPfh;{Zd{~|`v&Am^aP96Gu^`$pvh^*WV<>O0BeQEXcN+;; zAH(_ud*PnPK9B#Ar13N?dWg>mZ-SD6SzOko*@nk<(ys6F6aGNJ! z?yd7klZZYYVYcoboj{~R$@a;PhhY+uub=q{5BoZJ+YI81Yk};2cri;sJ3jUjeO8zr zUH|Sh|IXL69)I=`?)azs9-;m5#0;<{?AKI4whnFxW&{P?D0@4xgramjX$tIo7EZLo zU%K1hxuc(ZRs?mw$K?No3B7Pk>_y@vNAT@E>(ZiS9>LZ;VJa~NEPmUmx@^3%=Jz9x>CHkK-G_v4{xr`j$JZR^~ z?Kw#JLR9omLZf;BuR=xEtxOkxrM$2Ii$Bo_f5q+nB^z-x9{2gSGj+s=InxpN7#}2W zr7phW&){5*kUfgzNJd1^ityu93`zOag_H3G;!Iqz{;D7rsvU;_M^N(W#8w7(-%Rim&FrY1wJ{1`rY%)C-8v>>F-w~ zoD+_xD}Dzzn&|CLo_-H}x-OcKItVMHH^RRN2ffBG8&LlCEbKKue#&yJw=uOw6VV~Q zM~A%ErosDmDL%a-#DT8lG@mCjd^!3>YfiNS+)q(V`IXfrMERiku+;lgv(|-r$#>nu zK|egw?*z98XXBZ_mg@a;;hF=e?5}90(f_qG{fquDt)>M2 z?KN0|GssczZ||bM{dU`(iitU<5T56&@FACB9r7>zRI2;C{r7#BU78l$C`&(wIe6Sl zn#oA8)Ic{UISMQB`hSkkpdb2d0ZzjEx&Hfh`R`Wj^LBGX8<(KDenyOQ4_>?F_7&=7 z4wBDZ0l#(|atv2NI}O1Ak6qp(NXDOEeu6Mro?K;6DA&C(`r8Hg*4Oc@#_+4x=-^ur zOn#HTgI$QU?WKdwa8BbqxKlnb*~bx1=Sg~x;;b3qY3G8iW2s*~VVaNyx|0afG4zea zrXzaDLHrX}K`qTW)pOw!IsRmvmIP5QbS|{f&Uiha$Nw+{fADM6GQG=MW|HUd4ZKEO zRBFO)#DNt9``@9eU&e;N?iJ;O`1<~e|)$>=L ze#GS?3Q5m1^CPiqLT3|*uID3@suulfZVqY$>w?#V{lR4SEg8wT(a-pDd{a-dld*Ua z+aMiF13T5>d418}`H!Az#3R(tt`dHtQS@{^jPJRPxf*@tVJd>?L1U^CLwJO|s9x}) z^6-(febcYHz(@(lBk@eEpU*Eb0t{)M?%H+^au_f_>en+2% zPu+9DetIV_PdX>5c~Z9c^l)pipZ?kDiIqHK22k5*h?hK#*JKe^WC!3{1eqOiu0IN$ z)BC(~Su(<%D}v#}&}_F-1^gxcoq!2GuK>3j(TzI6RZFmc`7ZyR&-(P9_&(e4ATj2qR;xf#oC31Y4nn*!L58KLWT)Q2pfhw3ad z82OQlo;{DUw=2m(Yl8Mumi-k4`h~c&y2YFYru$y_^6_iZgF2Aq1MfwZan=pLb8M|rH9c+L_)r^&4_o63~JN8 z>-qS|_@Ve0@u%V)!n>JCmciArQ_*RMnCxT?-9;REGB~b2C+*>bb+Oz^LpOQAZ*{4O zYFK{?XTMJMA5ib9LeTGd++h?n_#|K#%m7EkA`#XA{ySrEJTwm0(2(On_@B$sYX50GsulA z%w_C(fjL0eiuLrpc`RrYYzRIN(-Tv>Cur)PbhYd~%x`)OZ}mBNqxRuPTn)spW>3Aa zCF{Ub3cxx33T@%1(Eb18FOdXLrKu*&lmNz6z`+a2I2a6GUJpNhklM^Au{*b6+un-4 zbTwyv8LziO`qxDM7XufR-Qqp6|9QB19VQ)8M%At5&@Nh#k3JE*=^wGrkzP&E6Q&XM zQsis88AMflabuCp4-?Ct35^d%zv>A_cSTCKL(^&jG%i434J2k$8~qgZ zC)ue`>qVx;P3TE?np^2lJ;Jm!C5%hR{8ij}H1BWEU1~r#np5!G@z|eMIzF2ZzEqPn z4B)=&k(3|Pr@aUnQngq`HDq&slO7%II5ljWiL72j_Crs)1U16WQvc@?oS7!hlqch) z9(!pI@9EEbCg5FP1drIni9b)2>w|Q`<@AKh7hV{4 zr6M~!-p%$@WmCwDrQS1T zIL9X7zyK`Rg?P@latbd|iSjzS%U-fG?xaF>8ZhmJ=d&?qRTk>!VE*bZzS%Lf&D}vWI#M(ZH^)=O>&83BJH~5~|G6XVABN=a6lA7BP5UA_ zQZ2}bsf^E+SxQ8{7LspJEf_|3z?Hmf6qyHKxz+S*c#C(IB-U{qGO;LF_dYoj&rx^q zIGFVSd%qn#S;&f~l0P(>{SIKqJ@LYHW!KtSU;Z`;%D6j0X*r-WYV?tFE1~lnsq!9z zWhqKO0`inmf^EmX&*zW^-k34P7v^me1~ zl!2pcU@mM+Y~}A=M{;Do3aZkzXi{)B7||$5atvSHcmMo(J;A03asegs~zVPN_o@Vzhe-5txN zD_1vu>&0IN;M*7l*O|=P7GjO8g$Hj(M(ktS&PzyxVj9q>6^Z5AQ1m(z{lIy_33L2>0x7PQ0{ z&`(w%w?-l3+rg1*BjHNIpXHNKhR3gIwf{}fiq`5i9Q9I;ER;G}4jsV0pxv+pgP{>ir`OKHi=e=;ct#3^?Z)aQafXZW~Ur4$mxu2A3E6Uj5_# z*jYx_Qbu&uJXlL5*jH7a(G=J6<#P&I3+I8yzF>al#La1;~O4ip>o*^Y|(DbG-~@`|ddJG!Rn zNUN&~71RTQ&DmS0g!~$e&uI$1rdOk<9Ky>cEqFNb|EI~*E5ZJzGPCO?ByVANKAi}L zx(WDvuA#5nXxEFm*cDwatXuW%`d5NWjdI(A+`*LKi*RuGPP|8ae^RZa>ywVBDwL{4 zs{W})r5ci|Q>x0Tf}~wZ6O+ot55~vE^M;RvJ+bs23#Ktus%}t|uH*xe(#OL};jHkD zcFRJr>@v&(OMu0B&>7ToP(3yOv(+>{#+U;gtSVH{4>@})nclCWlcq;1 z6r+l^G}7=a6CxX)MaIlRVqVBD^09g!y-~zKlf?WT`a_9#V7(qi`$!bh7cYbj|0z=$hL8nb znS9^Q#AK%+bw?8O@5Q9ubxeG3805vy3v6REm&nQ0$h4f?&vO%THJ>k-gyd7ll_oY1 zy>HUsm1x5(_#DA#cNf}x3+jLNP$7JROq1;VzRtA9%3X$rQ3mYsSp-^V^1qb-^Ab18 zNYXj`d|_o5S3tIWNY9|k%#m#B#u2GXMJ?M=GIsZ3l~iM`KbI$+^6tscJpJFaBA*@P zqkf9$`y74sDrg+L6|MM~y@?9kS;+5m$@5X2_cG`)M`G=&wU8baW6xf%_~ZQf)H?}E zzNW+XL+cZJnn=-mXig7NDLVmQ@L)U*Bhf46F^uXZl7Oi4FCQU-ca!;=TF@fo35;g; z(zS4sZq(wov1#pt)Cjkx7JUKJd#j>bHRJ4~$`g4XwUVd?N&E7>M7=(h1&OErbu)q&J!b3Fx4Y??aK!eb^0EMu{Cxb0QAJABpExC!{dfnz=l{M&$LqCPdlIrjv$67k zmjzj~GJk}Ij^ua8f*HG9{Z)VbDYOGJE8 zQdsv>r*hvhEG_5ODfT!MkK;u2KY|}$hcBZU`ao+=K^^||K0ggZ_#9OidAf)?glg7w zYwA)8l1-Zh4|FYJXMK^5Bf;FRaE!*pn>tdrHGEu1CjdOO5<=x=VD!maYnBDZ;GYZoXo|SMf%@Nq*@BBKUd; zr=;~XJhx%&Haeiaj8%Ei9wooanU3fUnynIb5KZo)k<9ad=~;j8-=m#*DWuvxS)!t( zjBxgmu~*UL-Xklt2Y%Ok%{gd99k^DZ1ueni%*P~!<@|L6e=EptqrR8oYtczXQup`n zD_UU$dts&T2%$4?fTS!-B(fj5l}}Rn{f4QVsI-yP)?|g8P^fajl(~E<9YXq36WgvHR8Kc~WN5IxSiyGB&7 zW;QM1Ta8(Z)~@#{Tfs{bcw*^PyO`RnF7{Q4(cTcW}b zpt+UChjm4450fu1z-QZzzdi!R)JJ~T2Rj|e2;ppmtclOfdnGI6toO#y47}z zd4#G?O)K$yUHxJ;smyog(-eld`NU-m@&?Z`v2T#OoZbv=h#XhoJ<%iq^=9@ufakt8 z#UcggWUWnHQj@qn1?Ir3aG&XAYg6^Q&K+=5>|XLK3gT@no1mPZo5U?h{jq;3wH4hh zHR~yqkoS2wjV|~%KXuiES>d$s^>AV^k=aJ?(51K|5K{iVe0s_AUA@NrM?Fr0P;zfX z$BCUyY^gBZNmG}Gb7F;EcP4DN4u=KD+;e2n55r4Sg>|1g^}}P3m(+g@M*o*S?I~3p zG194%JLzOYOSp}wIFV_W-&L`1Qh6~G3#2!vB(CbQII1J}Ue&0MUA_GCa;nP3$%Cvq zYVNn&-A*El%YusTB6`j=!`Ci6&kdY4F+=tE;%r{aI6X{^_)H|JlDmoenef+9#k!dM z+3xtBvyhn=oUBle^e1Uyza)L4dwV${4bRiCB(e@%q83iTQju*H_)C)AW>^;u8Zh2QI1zn)k0?=eX`h;#wp ziNtH3>g!&ONb@nOFdj0Wl3RS6sepg-5@h=%@)LL3DOf)h@fY_nw=oTAbYfqTjQR1@ zBlGVUk>XX)g}rxPzyBCI=g?&-C$pbN2bVC9=05tDA4INCBjUHn7AN;%3{{dhm?X}y zCOe2UJ+Dberxj`BDIWW?zb3Cmc%Lj+{QSsC<{X>ERM%JG(5NKcQXS30D3Cng!Rrw7Xw^om@} z-Di{CbOpXf^-%LO5+du(+t`11zJMgRzhwD}1N*L%>P}e_t@}>0?b{JOA8*wAY99Wh zda-Fl7B&K_9rTKwhDW72c}J~~zKXy|pON=NFp4PXRCxVX1k-&|>gVbjlRQ1VcI+0@ z0PFaW>+Pl?Z>O1!c;`ql##bhP>m#w&gu02Y5iU@Me;40(W3dtR}iV+OP87M z?q0fseu$s6I(0>(=|n%twnFyzr*7sTHTZ23Hnj4vR40&=pYk(EpN>4f@>$8|$iZ5b zAAnV9&NpAtSuX?L=7;QA=3=7xnq)4$Qu9BRMJT979P01JnqPvS_r7~uQ?SbfFD%6+ zkL9_sxu&OG7`X7Fc!7ACa3o&Vt$0RnMT3=nql}Nj>|UO9^=)53p1>gZgTOnE72!Q`1T zrXn7|lI$aY!a~Z;nMoT@?hGq_mjkUn-~VIpEa0W8wm&|5pEH;44gsZGP)a1EB?Rdb zDFZ|hP)Y5KtqLpwO3ez|IV*I3ci1KW%lu$oS?v>PTt4C`mCyn-~!B@dLJl?hO;CONz(LJiPt4IE}HuqGPQz<;l zayi=;C+F;*v%fp7w@rs|RmiRs{X`$aI?=SIWmZCuE8*cjW`uBh5ZyC4~qO_GM%dIV#0Yq+VD zWY0@f1rz#+DSij}cj;kL0L14_R|hu7{wX^a=8Q>7g1>39W}jo<4OvD*ph6x-lQJ)$ zBjAm6T$%@x(189rMPMoF$^jWM`Llj$#w-YIAF(jX;*nHBwn`wgE66hrj3&j0fJ0vz zedga{>i6ex2lil9%OkD&Q(l{C9Wg9(ipp+oCI6o91>J6Ppj8$VKzvg5lsqu83_ocG zndM*I8}tz^P1d9*Dz@I#`x)FOQuKf;{% zpB5rI1Vyk0qdz1AU10PLzs-5GnwX|q3jhMoDdu%=pF#qx%j7@ArQcGHuoSw~ITo4v@2*Mixo*$4s0 zS45?EhA2Z?UD>cO>mV;H-JWb=>`tV6d?k9&K1_c2S@?q=%lqToleMWf zt{KJdHE^K8{8SYbd+}chcFSyoar|~|+psx%ZJ8{2b)(2sodlQYfhfzr%S3=%U0!M{ z+Jmz_n!?!{g6x%q3t642re3Upm^PMG5xXEADVPonyAh<@beC+5&8!#yL3!HC;O;#{ z{nhz&=-r1tD|yjJ%{b-KTgDA3z+Na$&}8|h*z2CYUDS=(eGc;iS2DxrJn{=8KybdM zQ};l+pj5|io(a!?PqJ(+xRUIZ*{qVOI6`&D_2|#ulL;y}#xEpKOiqc{MGJg8*8nee z7HqeLOblIv2eq7Ds>c)6kB9p%-$^g&UR6zq)l-gjc+)-NzmMxDOC(1oE!3Lq9RPkJdVlbk0M!5laZ9)q=;DSnD(1&mA4*G4D35&g~&rv9e-s` zbxC~UOUcvCBQAR;IV9N%rosT?&^_U2RpApWfS>KjedbGf0cq_S;xdy`#caA8*`>gD zQZKv)Xq4aFGP=HAy%3Tdf+(EyA8(^k3^JQToG$9u=kO+1Zvw23+9daObgPo`(>`Fz) zaBQwwz$ef-3$w4q4K7TSGb8Z{wR)eCkL&CUz#S+`?A@Mo8?2#X1G9(H zBXyXJ)Rh{F8{#*T%af~Axe z{%Cf+B7{z?(Kz2LY6cgfMD!3Rvy^K_oZl0c+mG=4s#2eSz8?(I)}2)vmXe|1^`<$Y z+a9ZA*J-91gGbnm49_Gy!YAWblSd{Gj87(4RMwRub1(snbr7pPfQ;dRWIlROyQHZN z1ylQ`8qJXRkVQ0JpExdhX5+LAjVOy}|1@6A<#f>>PxazJ7~s>~G%9%7urA7C$qUj{ zc=KGhRqJnl7k1Qlr4NivWpSdiV>X#gOu^2~0Xc{W_!=U;a(*2hj}E6Yun$tD{G)!) z=B&zMgdCfg;hH6_ie<%%(zbo!)h_g7sl8txy-d&co0(*p8}F}r>eCDjlWnpUvb?BO zuh?1}rXxoG!EiBepx@Fb@%m($_|fPa|E#;6%EexMO3Bn(%MQ!84M;#vSxH)HyRQ%} zNJ|vrv&@Dl=2*ki-4pMb?46b5cz28o`Rm+Fke4PrfBBT{RsXkbKZlvxI#XY$8~JHO zi04vaHIq&TeZhQMQu{HGTHwX>99RPn0;%+a-1DwEm7WJ9hhgfg?4g)!s-!4}9y!&u zWje+w@x}CNJ|uoHx`m$eN76;7F~4OvzVe~+4`fTFjm!#$iWbEM#b9JCrRM8lIxakn zoj4tV>IdT8j};KYXIlBc;SoU|Lncimy*`j%B!DDJ+#gX^d@NU&fVdq|_GPxGNp*j$~WJk2}=8a}Xwp;$(|Gz)6GiO+zR!e*o>2~q+OHz|?3tWQc zu(EHYs}mhpsMk9P-PW4jFihEyP_17U+M)wkz{j9p*DxXC70}A2bW}MSX6{gOmt&Cn zbzCWrznBl|hK)Q3&mpk0vPaCaN!zk>;mqN%@&r~nCPZA`$==BRqx8yJ&K-SBKJ^gT zH79eQT@ovq0r3TF;c8LG$b0pXjNzHqPn{3*xpW12Y)Mw)Kx((@yT_P_sIen(0Z%_5t{?zmt(H zO5cO!)>OKu=~tcFxeXG@Euy`-RHwDLLq3ek=E+v%vk3{ublZP}0M2A2^dO(5s@ zarByB>E==)))FhP2vD*TD#S{o&F*(YnS`~Tc?hl0ubp9Hy^SVTyb$bw^=ZwHE`gBhM5v2)MC;i$pyggPSA(tp)i&;B`*GVQxGlf3uFiFx!y zT;>~sK;7*ZfVxdjd_b?7I{Z9jHq7_aNh^p{P9xVgjgI28v zCeYB)_%4AFpJtHB%awJv>J@2E)lUWNrv^OCX1-%|PW)W*rsQ|YQ{s71ODs+jpIPWe z8P2|H>m;9=J0?wRvvDO&>H%9CDJjM}o#$Hnz34OYPJAHv>>__9JhBhb5AsiJ(x#rz z?5<|wv?BZQ6Wv$d!PBWg_x;gS*UwH>$?8ZumSZ8+S-nNls2y zkGn>DQAw5y?4T0sUMh7uitrx2Q#+@ZEa0y7B}uTCdA71iLe>-yHzymZXr!{A3;TK; znqdr{nNWCnoBBPoUEAxKW&i91d#$stm%Qt$NXtWX8+itMItGpTy*m~ge*%b#7@%P$ zamdz&C)l;tHr!2kPOXz<%9uyWK@=uRm_Z(RjQh|ZKnAcO`I7GBUB_T4#htJTo}uSM z`a0pt=|A-|A>!+DYLPtWx zZW_xvGwcY-x2FtRK@t-rK{FvI!2O!yOA|-D!<5sL-A~j+J&vzcHT7ias872fzqS)z zP%dUx=VrRzETZZk+%ZH|ClF1JOFZvJ`TYJ&qFzn${EE2u(T!f4P!aX{(#ps)mF$H( zO7F*C{Wm*-Dv?tpCCJ=ztz6{yNHfYcpO!ZiZhoBjz0XMRIZn(~lv){U+{CYz^^)FdP z!@rdgJlpN>YedcIc=l1U9CP8m@$a*C4*4+8R~FXzgr?)uc#`cw@B#FkeG{wcC3Ghp zJT3)^U+J4Mg}Eeo{!!FyJOT&w30NuPki?R7Cap++l-`^*d0V=stiSE6t$}uXM}3)Z zU{=oXI`PNk*A>Esb%l|CrGGx&J2@t+b=Gmo-{PO5t2})G(H(p9^i}~MSSj)hLJfrB zNtv-{MRC5#ruB+%NxqRaKWk3%nfQ|E0JM98>_df=N1{)bf4%8_?WpJ7w(Dr6?WG+R zT4sBk3k%;G=J7}L!+HP>Qj$3IOt&Y<&k$led0m+nU)PZQ@3?*2w&&RWf7>MA*3foB z`c08dQ6h(vn1eJMglsw!x6bj+nf6zOK3t(YP+-N`84BLQ?z$J@WCX3H+^%$15zb9H zcrhQlXQJHkfaHv<`dKZLSHx#Tt+4jFi4iMt!Zg1_y(q*%)p?af?`Y3dcbG;YgT|L1 zPzbFmPT8~mDthaD6_<@(V&3&6cPTOKu_>>|tWjFy=`MGyeU&7oeWifqDC$&3x*5@I zQ(ubSL51T7lKJBos21-?AG2YgBkKPnS;}rNb$45iRD#r+?K8QxNFX12VkDY>02SF6 zP|?sfs^K4iMSF&e5?7#EE@Ce10ZjIK1;6AY7-xrKcW$7@WGOw8X3^vLEfDjI=<-?2 zj{)V%1J2ZpyVq`Jzq=j3deS7O&4NDDQz<&tOHXwuXmw+^4mA8MzluyoIarPbh;B6_ zTz*Edx2BV1Axa<>V|Z5?D&?N>xyVPqM|ak`#J)56{xT}&t|h|%8b1Dzs5DIXcU&{r zPvLZjO0aNO+bb`6zrA#4X&KS|?MMHu*T6s@WxmmHIQM%}>DU^da4c9_VV)@MMd-bD zC;IZY9AF7DK<3?vD|g@2SxMZN0QHHP0X5+{5JkET1Uh&ol3*5 z=m@(@(_ul|1Z|zOJIj2xoxE_K^hxQ6s3do?p8Wi(=$mAdtj1Yuv#!XB<8Pyz$OKMe zJ%!Wj4)wCwEG_Y-tujCBzx~TjPLO%+vR?9-gb+@kA6b2>pWdb_`FHmqQ#@i2(EgxB zR#}q$%w}F`^Pg+0D!X9!YG}7KYi_g*otLOGC&r#;{h&W2CY7G8HH`h{Idx8~F6KJq#>{vbYB<=PJ_p#}}!}quD&p)o6R$s4tSl|gTRxa`< zM>FG5$#V2>9+PzN0>}CV?tWL9+U~>1f$y==f6(XYUThb3j<&Pw>;Lu@o;{0mb^w{F z-$AH4Py;nLdY!r5_e4GXI&hTxm=bdeb#;6A`EXJ9rpsqTde|+bn(boO7B2R%~!8i>u6Z z_OI}i*}u1A|DIk^+e7=r7;9FWnEV1Fn-*>kp2a;(TpaJJ!w*z9&zkrcrhPZPoAmSB z`h_QueJ{nSn+d;fh*yn&8~>~dC-Y9abk=p(_||0i+aY`N&@iu%7hCNr zQ5i5GrPu!YJ>8LO^Ut+*_6o?WC<=dM2tBT1H;!IC`+@+S=tscHx(EIL31_1xxl!@` z{@1>O%?+nLSl}$Yk`CaqMX4(s4Hx*jI4dp|JUI`9t*nqxS$anI~a`pC)$d4M#xP*uSfCBxs&sd(3{QLZKXd z)TuCx`Y{Xs?5K9M0>0hzOiQW^Z#Q-`T@idan}Mupsn!ckSKC^f96mWy!j#XhhV-4! z?B^3e!k5t(YcyJJbX3wWg~@ti%6~hQ*&>=_n|*rR=C7A|_1)oL>F1D_txjs<*HuPN z+QNLem_C9--3z`e4Epz&i}naP|GXf8m6#SZ70;p$sJl988LF=5O+n}6(Y>hz@qKH*2l&JsSB*T&Y_behk%i5B2b*5+@B4S=KG-=^POcDp+l9=- z=Var4@eAoeGc=mX1eKz&n+ww4J~w#c2z+04{{K7WJ>0)Eh3?*RY|8dkKrfzvpE(R} zDo?Yp6<{K!+4fe^%{pU_|S>TmF(hsKWZ3N{;Pd zI126Iv3v%@>Roz6@9k~{3weo|B0W>r)NBW39+e$XzXJ7FtVXt=74hEjtm3O^_crtx zo`hf7&()#ocOC0K0_oDMdex);_t_(173_|+3hIAd0>7&xpYaI2nb(jxzK`iQGouTm z)9EeqEgkR5Fa!BmIx-CfUHTk5`xevc)<)kFroN1BD?#mBlASI_6~JW9aBcD*%I*Z8 zG@Rk=tCYTvpe59ery)M=Xn3h_GTY`7xL?QnCnFc-MN=&IO|d@xdFEAQ(z}w+Ru2Z_ zrrP@36|;ZFAOEiWUS8f;mq>R8eaU|%x}3%I#7C$qy`CrN4BqxE2;wyQfOi5NufsiQ zeqnZflzG+g9GNl@@%+`;wNXAlmN{ zFC9l-<{hR#{XiD=GA6F>fj+u~v(^{gP#+n!Ie34U5B6uzv*n)!DNzU2%IJ(npb`fo zBXf!EKL7_`4(fA9G&0T?FO7ds)<_nLZ;cy7=lGxS7|OfPsa7dU9o9wuE4sKG5lv<$ zbqyqD1l;zMTotB~T}CbJC?d+PtWiTwqx_1UKa(&ZmpxnXWqC^chqEwFW6rg@Lk6`U?7G%j@{p{={~zAgfsiO+OJ{ z{`am2btq(0=!^Oa7~Et2T;lo9iT4}B3b_KWZUBtCrpRe^>}DzK?bhsqG_}@FmFhLo z_AS}Rp;)M8B{#U z*`EbSLT64?`D`n@^Vd!LFHS%?V$uDu@yB9WUSc}ZD0)}?25)~bebfi~eYxA)sCBDH zChuPGqv^0n`(TatW5uel&f+9yx20RYZ&`D7Ur_(+x=7N1l-KaOtH4CUi|Iy@WC~0< zVxN~`N(_Z7@fN!`n^o<=`7mp0^#WV|g#S-Jkp!v(Sy^<)zUZdzAdaK)3>Lw3e?0L6 zvu}qnwdX}7zY}%u3$azFfYH^X_sG?$DcEgYPmt;xh&~&@9$E}f{zj(KoaB4p72n5x zR{>4E7*=%elzyto4(!3{(0qmez6;uE@xwLky9#o$AM(;0?J*YVIi0Ra>**#?k8WvC zF|~2A|2*11niwr$y5R__U|xi?Rg(&-v&f*6hECjKdV#LBe{y?Dw6d`R=eb) zcwO`vvzZoBr?i$RcmOErUM`DS*blG@v(fwAiP!5Oxg~h6|Gok{QWEW)ny#tAYBpiF zd$1NKVTs;hmf1viKelEdxWPU29(~f^Oy8!iXzeGc={OlpbTg-U7!$F&M7PBS<92ax zxPr;(da~co`C(Kqor_;tkkfWQF~m|l_8IV?hO*Laz_)E`tIoLbel~rs%$=@BUZXub zeFV1cGPri7&?Os?ujP?v!t^=x1ic|z2%`Em>s;C0g{M%4?$>M4J7*ESoXk4UWS1wQ zw~yf-#-?6lU@MQ}H5N_15ZQj#CE1(f@%X=GB2_;!FLTI6AIU_}ywrItBlK~VkA5V@-zMNGet90@`rVk|J@zKAS zgmDe^B6p$3ieu}q*ArwJ(F)`osp|tuF1JpH$GK2Q&lmQHN^qkf3IpmKHLq=zl{k)K~dk3=lE~ld& zHSU)Z2e+lF^mqKu2jWW9JFkgfjX#QCidV(M;{u$9W21wj9^_G+=yz}8q&(>6Cpi`8pka^T z)VIYBRp;JRZI;Hzw(nX0>UWur4J+H4EV``e6!<#lvGey6@#m%j?HIQPIckGXyq=1R zlF^>bF8__n)QizHb?NW44y!eqDZX{U8h)ea=Zk2T8_{lySRu`yZ_f%<#b;D^^ECSK zS3hgcKToTry5vek4lU7Y!|)yFA%nLutKtXhbq}U~_bK9|Y5rBRXxGBHIx@a4ekJ~t zx{=%IKe{LR+yVZ35tt-wqUNJ(gA_-GN6CEsFd?tT3BrNrp- z@Q{uIJ?V~hYlPpc{)1cVzvg`1{<%W-6$lZiP5)Mmy$`yzBaz4u*kRMyt0kZatJ&`d z&@(SnxAZF>#eVJx=9Ik&U+YA2?oF`gUx0?57r&k?o9w_m>oNS-E?GQ&K3)*Ff;n&l zU1x^FFFQ861eB{;d={MVX343^%aeB|*CsEa#-};@etFzBdWU>(4f^IBkC*%r8QW0zsck4J(AqahAJg5)2mi@9k$oQYlbD_F^}+M2cA6mPmS(cFlQ z=l6C_*pI|x?ZL{=#>0Z62=}%UvuNsIIm`GgqKBtI1{b-p^ek&Y{Q4Vf^8zvNZQ!2E z(Q~u7(&58iPI_?4^a z<5vaL??V4#lppyTKn>osXlisc9&9sMnIF=7{!}W9tKm7XhsQaNYNo103Lhe)x8o(A zjUPJ|A96UWa1hACetcq$6tW;G5pJ?8OUdTNH(+7vC|!-`*?;3H9mQ_XBzJI5VkKu| zExgG$(ElaT!b7nDce$^Tn^7>MJ|w?+bhJA9Jg(1#`OD&$lF4Lse2#Xo0c$1m#c#(q zGlPCm+yqahbi7yGDjtiU@+Ch#HTg_dAu1Gx!^b-=Yjjp`e3TN&FY!;VW=8#(WVd8J z-v18R+Z?8|7R19pl?w4J@^)wALn_rII?z@H+DAQS<6Hphu)sh|TL3BKVr=N@mxsZ(T71-7F zXn;>#ge`66`eT8Yg9Uux3&Kn82O@qhi1@?)W%3=L!n*pHO3&x$G<7xgRL5~5nvsY3 z3H0Vp?DuS{!Mh^|dl6awf+zG6^`N)$2}?K~lkgVR`^5C8`oUU6z56VyMZLlq)Ni{1 zXS^L}y+3C@y_%O(8T%l*@ncqV53JT8di`GN9%t%F6@M^Q@~c?8U!%R?hYv-&ER2>% zS4P+Jx{|-09vx4$Zs(|8RETwcoE4r&ua!e)g<(i+XU#{F)7cm254Iatk=*cqCbJ5ah6w{Q7bJp(T^c_XNvBGrZx(Qro0C8Rt zeY=j`J_Foh5|N12EQdeTa zeL3m*h?AeAnqn#XWE^K<5T|??+0fImi(m7Zi|CZF4@{^6c$Wxy0OYzRnqgt?Oi!dQ}5E%aXL}at5IT;+~0^90NPp^mK zGvbob1iCCYAgZ_z|7A3%?2I^$TgOeA1w9$vHPC&=3f}16CqllC4v>9V~+X=>`K-<+*9W1F#cJ6*8VznZWc&DCw$uJzAM^!Ihpx(==ERxtX;r=I)sh?g+L_K7BYfwm zbG&c-uVn6cU0jHJsN~uZEw=(?7W+XJFNQj1p=bM1L(tvFbVWEQT1IZFp+6g2Q;Xm4 z$n{j6s9xXdEu^Zau{u+aPv#2s`lIC#*reWOX9&<7JLtXW(FK&9$b@qJ> zGN-l5zQ=jV5cEx4;flF=?o)JLT|BSFWP-27F7B0D>&*Hpz1QSx+n?>9ckGxI&>o~K z=Hw;Hq7~)*X{ubq#C$aV^Zp`ylts}v{|SipFy|KW*E@&GhRX5sipz#WUg#(b;~fyAZ#wH<`C0XdZRTvFT;$8fj@xdp7Iu zqe|BETqCsC>%=F|f~gjwmUSd{u@j$=IVan8WJf*Qw#Z55s>=EnXBEnDhegl|lU;st zw2wv0;}UVcXr@2cU52eZA#t_q%OvQA(OcAfJ^>!Ox9bTPtTpe_>?ZY&F|Jjp4^(BC zb(}28x|Ksayvnqj1;mHH$EBmy{$1wAmdBr|&2OoXWLdP8CT*v8N&0MCzO)zi>GCZ! ztt>qgh?(9@qWqQ`#3$o!ar@|2|FC;B@eLTyTzW`6=~u&yeSi*z6@71a0?=}R@(%S11IWe~$Kz8~sLhDnmRa|I zwr=5cO7?Ug;T)7<4>i|!sXM@zh3~cof8oBUJlzThlYu;dwb0Cn(yXfH8Ekr$Kl{X; z^RrFwK(otBAxG+vRs!$hYG%^3h-yYJ$K~J$*7PmiATWM)rYOc!s1K0%Et_5?^IrAS zuwPm!@ifi*C_>is6pZ9zUjh7kf$v5RX@9)p-gs8(g=Uj{rNzvChO1;=|Nqy&bSlFM z)w*hiiD{lftlA*t|2%(u)Gc~C`gb(OFLO82Ge{@YySw~+dIFA!8u*Kei>iY}HDecT zCRpeq+Ef7bfHK6{w3S`ue`96-d5Y~>0kdjB7pgB(_AcUG5;uYu{R*4?7xLOG zy>ka)xw>H$Ll^PT5h&=?Klk_l+Z|>~w>n~m>E8v=n1?6+1()Yn5To+W(cf@0$dg{r)ZlxVb+n8foC;r1Gu+je zM_tbq!-OZ={#ap4`#iHZwImMZ~q5d?A)rBJzB7-*(ym=|JF`uVD`zv%cyNn#v zwA5}C;dkWc|JiPAdRAp~!&wy`a3QGpyaHgxexfJaF#joY`aYvlU=?>g1%`nplh}HyhpzQ8 zE)0`sKIraUHV=&ZIpQNcHWmpMKbIXjzxAa+m&G&;|3*MDvU8hz0whS5J z+pvaT!AE|K_3g(TnNl$An(-Xc%EeNDDo)Ilm-L+n8MXDYxk%Pcw*afwi!LrlGG*nF zsA^Q!UqdIac0{4=kWOh$n|iM(F@2Ss+1m7d{qwi%E1>n&nKaZxQk|Y(REbVrUvb8+ zr61QX(YIirXS>VMn**`gf1DC#SK0BJJ^S5m`uDVSn0*ztW-?X~2|g%sw>y+xDGz~m zR7Hjhx`W9Mcj7lp#)QDBPE=KvLgy{pqDdasDPFNgWAsdZG+Q4|!PowFxKT4;K#Sk< zkef>_|AAyF-yyHI+O1Fg%J-{q2R6a4B-b(AE?|G#hTCO6tL>Anq|<8lP1+~ex98~i zdN>*L%gLbAZ^12wF*Xp(CtIY7RZY}Te^=#)D&t$elETz3@h?#q)D(~FOL9ZCQok#t z+3dA+l}*brYbZ?DFj47<+At@6qaJk%HT1)xmdwie$kl`cHHfK;hx%^hwi0pk=#!|f zZ_LD^i(mH(^giS6T-gS8&Zy36mEmE0abDf0{%dL%zjnzSt0gY`_aXaMrwjy-ys zzVw5@-8-kOR+#Rd#&PAJ{;)fUjz1JX;0pZn_I?h2%m>);iaft^BW2kY&2`gWic4X=-E~dX)da7# z0ukf$^o?nOHf>1EeHA(W{ozrz=H2orBuQ2q9JGRY*6Fp^-rmj&DX`jSd@VY+rH?hWtz@(bsu7f)`DZ>Vn!HPY#BZYrf2*_`31?jM z<^rymo^4}Kv~$j2c0Hkdj%LYd3by{N1*`u_;=Ox)Vfu7^NC&0_S=Ls_U6?pyGfXUN zC)v&EJ*H2rd9>MWVFh&YJ5=K@V2@skUWtbL#qJtT>`?qiRf5W9T34vxhslcne?AMA zS+j{k+FMO~Heb6KjOV$oy3Y+u@O8MCEu%~PweEUmo=i+Ea z7Y4R+mqMt7wiV#>OkPdXPa8(4?&y@M3SKJHwCkPx=my(e=)eO|HYwECx~Dc;{lZ zyTUr>>>je)as54e^q{=tb#Q{erndhpFoSdO6510z2zLmx%(8oclJ9MiZnJvn$WwYV zumvi@dVL4%_n4?gbQ;yI&bM%5;7E7n?8(!R53%dU3MTu(BTi?Dgh!TxL9!06RRov( zZE6R`Qi)X^rguwphT=bE#FXuoA1jW5Y`69Q*C~?!WOE{m^NtnNZoTKvLGM)tmEYgZ zhWkANFDvYhYMaf=3jW2eZCPyHf+wUZX+^2Zy6DdqbegZ{-eR(J5});1n0K>5utxH{ zh6dTRM)|z*e5-1aEas@~#o>i1=hg@+0EwLVxu!*A;2=Imts^X_e1 zf#3rNl-+WZ%JCFH-*idb4$qlg2mR@RE;^9Ce}O2bLP|0ec?4NEN#FI+pKV(m{r0Aw zk&t2YjEZAB&vyqiQTm9uXZ%RKD*Dxb=iZ<~?(jq`wj3aN?+!!Mb~5(K@{v_iV+?=&t5?9DA>_T}!HJbE*1K?{?sS7&$l|(4Y zO)C0S4#}{p8|Ao2X{psRa9*uo0y&+0bpW2w;*&G{2 z8hcy3$E~}=zvj1s1lTiZ57JzV(y%J-bw~TwQEqx;T^ejhca3<^i2m4BM#te0o-2C(PXDeX)9k2)K6G@hGp{ld(0AI2nvBP)R z@O!A5djk#**^pFTAxPj~hbHJ=Lp&f0B?e;fyo%!6ol7t0&p5-~nB(4`3~=mPZ_MtQ z=M|8TAZ3QZnfGPZ&St(T2HzWY%$szgdy`JG-Ox`rxdvo`2M|{ZX%XfU>aTTIX+8I6 zYrS)RW~&lVH>>6{mSt`m9$Fu9{OTu8g!gnG{e4>#EnO5ff#YxsK9N}X;{NIPpIV-LZ6zI&DdN*a-+xq2al*;5Okj3kzKdrpR^l#Jh&BxugAfIIJ67 zTe<`t2L2$A#TdiNw(dAa#Q)M>{aw$JT}E`C<>Oi0DlT0A#4~O_*kr#rZ#*EbADu^? z@)L9~v^o>3E>SPbkPXq))z0J#%fbNfNM+M6*r!GA7uOg5&IFj554gefRbEG*#KACn zuR^qXl5HJGZY?holAhrFSH#OXU2!`VigC!#zn6L1p7Trlk!W86uRJ0F8Mkdia@rP(mbO*iY^7gIzK%5W2lasOcw5jr~n;8o}p^$QWw!%xe4}1x<+fKj>zFzW#QBQ zxW1cabmV4*IwdY}1>F*us#B>|o$f2q*Q^Aq*A;0MQ(syv)Yk`_w&PY$dk|L8JTc{G z^t8&j7bcE6(^Yh@`!#e9{V?{?jdXiy1y^MQr%yc~R3E3A^Z}hoKdY|%|K)4b6%_B( zRIY6?M_O3OU=*|%(QviuZ%h{H{zk_6sp6!;zNExuBHK= zg9qm7VFU>0_C90#{KnA@Mlk#)1PHO!QlzbcI3u4 z?w+`o$ud9q2cubWE_zWXqvQRpbQP+MHrSsiTKg-%%sQ&rO6%P_M;~OrS3S36G2ClK z>N!@sM#$o+bPzr%I*&JGo;uayT3Iyy>%%g{EwsID^W*HU8+R zQgjWr;}iPwN7PK;O1IHs^o%`$zQiS;pL-O&A!Zes7s_U79X$_XU5K3dVg(o z)Bbb%)5PqqM<(?H>OH&SPp*n-s~26xRS$IYs1}hVi#u(Stb0|gtC#lpK=OMf@GSaL zW#6CPphK8KF^tNHJ>WKU;pg%~?PYfqo>{x`&)46#0_lCwJ%l|K{;_B3EHoo;aeFj9 zE*1}tJ5e!F)gO%K@(O)9s--k@W<+2Tv2)ICSR+Y{y}})vF3m;!(t#QrM+Hq;I@^3o zw}@B#6#Uymx!*}dhDB5UhNLjup{}F9=S&8(-;dpsuBvXlO*l0V)75zcRo+iB{jm|u z*K3$?aF)x>{F^TLPgY&2CkW?a)2oH&-rfJSwN9^gcutQTRUviA21L_O+jU?@#MU@fZCyX?!Z7ycct7Je4&YZCmf3H2zCP$zX6lf^nQ&#fuh*%>ZB z{k{9A_y<8V{qO8S=4vS8t;$W!6>17I^v}t zE2wG{SHxI6x{7^;>xF-B{Py4ehmac0F)a&9(-AGOnvMnosg=z`^==>j%T3q#e&h@4ifl^xEhY*(p@jZw0C%+tU~00qR9= z^_^kSw_+B~w5S#JCtaEI(U_{wDfAYoiuO`&P5CPO3Rm3RPWW)(f1YH&q)ry;c{btJs(RmbP)*en0=bV@Ixl z&RkyfYDHqV=4iA2VC^R}!{bZlY~1MU(`~IL9oS!peqcuJZNw~}GGn}yd&9j$$GNMc zK5+qNOxH*rl01+}W+S4T{EyTqT;ukpN?{qcax}G0!$I|jP}kZY`_!NO%pfM14dy#X z@bhKh{pH+bm^wX}u27V2dPAvn$ivi`mT13|-J#6#xrFJ=v#FmtA$o}!vc}4-A4M{w(;+GGBy_U9U2o zu__qgy?zKY%Z_&?$y}bsI&>paZ9@E54QnntX0iN^y0;yFov?;Ft?Dvu6Dk|hh3*h) z`Ke69L;QgmxF4dK$1rEU0oj%QWTyHuk8BBR(g-Uj?q7D@Y&)~#@AZHEik3?)L58d$ zHm?t;-?4BgmN7NuE2d>FW-{mqe_xb0st?MMV4C(p?sev97hxLEJWgLnJPpZR#Z-mG z)=bg<^YxU@$b;9TnYRtWr#hsj!A>Vf@;=k1R?v_0SYo+?%*&}n6~&dzvVD))KXt+S zR&zf`qXW8PJNDt->Seb3O>F)1)%oYA=@n31l?%Nr{;}qj)khK!z?&a{6fB?@)^}iZ zE6GF;_qQ+yp-5DK?Dl28JM)#!aLvj7tV71{4c{wVGdFJ{u; z;`m??!wJ~6(foWND6EHduSsUtF<0^m__E8HXm%!dJD;ra$=uCcwBKAb`UT9edXxET zqhNkjW_ta*Dj{F3cDi!t~yQ zm~A}F<>K?sU~ZMp#Q`v*YOz+TuQ7&8dNu#~+dnIi^A#{_UJQ?^7QRa-yt2cIvrguu zttB5>k(q7lnVoqKImyn*@>1#-4x@Jcet!tP6wYz2>DaR#6hgBU$6$ws@ctfHn3l+G zU81oHoOJQet)FAg@AjW7{IdeP-U@^>RDq1o{@_DHiG=53C$6F+^^;6LjNr-kVov6r zbRwz2r14|nS)JsMp&Fq)S-nf#2v;rfY2r?%z)m10YDb5MU1eTzdaV`d=fZz4f!|n* z)7_SHehBt=8uL9bpkMHvi6`h|^fmqVYBAaG9A+AJ_4m_N=)rjZ_`>+zWUgc!zaB4( z+hOY_!CSl89|3meiHSZVZC0CZ(|w})A|E>s77o%k2M z7OzG#EyBi6M&As@_dO7{af578R6qmMcmB`c{#k*)W(6!Z&W*iO*M@RnVl|P?W}KC7 zoNJrOI}6|OTrw%QGQ;a*W|=l;g8Ak2gsDiLU)?OTW{Snn@=wGwt5#;pf^AbqQgd4PskdUf`xj3>%r{bL)~EXTYIqCvfzC0(baMdI$;j? zIRtIkim0#}t5M{i*lz2#^zdV8#!J@7v}TO!CT? zZM3peK}ya|Xp;ARcoeTB-cNi3FSRID5iN*vk7ug<6Yh7vFLPTi^{+&Q!QhUJ=0z7q zS2M@^5)j+**wym%khr=ll(5LdRC9D30bFRotL#d>)fn) zS>v+0WmQRjo4hZ1TC!KNT>MUaLp+<>o+fbxGBvs4+;LH^(IP&C?_LwXm`o-cBnKzw zB(F?vNWR7OTvnX?E%|x!<>cMT<;h9OPRSzi)A541LmY$Kok}JsK}0Z|nCU$xEZz2p zWtR37cVAUT>h4_%xu}SAR7XbYgD*Ehf?JV;?0}`|hFG{-khn%{JahK(+3MUo@<^BYJL~f#Xch4QVJV; z08{OUxiM}$uhDJ@aS(Pi@gwK$cJ6TopV||QP*!sE0b;?KJilbD)@a}dJwh* z1XqB5SNCWvWfjTkeB;xWAMI>2r$#b;d4ypDVEZ4V#| zG1(PI@}{vi)p^IR#Z(9xE)y*I^7hKb)3qkze4DuTS>M_(OwC5?P8mmgOnwn7m7r16Q zS-7yLwoAGzdk(Rxs&aB~b~Wirl9xT+mstVh>8@}AC;bs-s8sjgpab8Ho&u-82F#`! z65f&+FZ7yMyw`&2#HKLjK7a{aF|I++wSq9A2Vx<+a0ac@gsQE?P0<<#CaC_Um{Hwy z)aRiUHD%T4r?Z%OvPVbV=@VMg^~Uo%T3s>7AAAvA9~X^&ji&oG?pZ2CW}`_8^KR8v z3TgE$k**o4b91s{JLkRGCCXTB`LN&WJ(V9lHX`wYo9Y|Wb?soVpt63pdk8+;LiDJ* zE2}az-RDAbndWA1|J{Z=GAXkTN8ygDrK%NG zjgg%%yZv{xE4@>zql%2p^#M=?=~-@XpWFY;gtXnT2cpTn>-ojOo*#ymA85VyNWvFskc*;#Cd3j zeEwtVBi^E3rxbja5$J`Ed`{+7Y@M~zJ3`-Wx{BNS?@jmJo~i`vBebX$RY;wDY5x(` zxofFVd5O4^+3f7Ad;#lPn%Pk(`%`UtZB0(pz7*%Zg^`IlU<}Xti=y_?8BE%Kn`ueC zVfU!&(xwBctFCNHs3|Xqq#eObkTG;4UEx2XB5JPt!X3z7^~V2ErK{;j0RF$6XPb9PX1>Gv<(TU(m7ZVXw<2}}U&}Py| zQmisf6%jf6vTJ46s9`#10lc7LiPzjIz6-X#Q`8hBxCr-oBU;D0#o6Q{>z^Twm97jG z6HUH^Iyg$^_d?^YA^UW(cQ7IH!Nsdh1TdJ$=O#DYH-RH`ZgfjD3{T<}SBmJTF6*UP zpk+BTrFr^1eB!~dI*<0v;2e*Ib+?Bf!%W%tK>=(Qj_J72<5$lkjp}l?IJ`eo{x#Q0 zebl9SiV(}qr*`TQKL=J(%P7lF24%(cM{Rp2F;V0TBG7 z6aRL{z@4AYSOrzp4oJdl8fx*EHDa>Ct4tHRDmu*H>ppYUK?EA7-Y4nOxiW86oos63d;I8DQH7I_oMmgj&i(FM z;`t0=M{z8F<1 z>%a)ga(-l8)%#IVclu=PxOLW*!r8DLEeI|#0WWL{^$gQM{zk#68VFiA9NnRccHNU~ zuB5RLxWPGSs<-^gs5Wa^&d+c+bB<PFnKdAV?Ibx{MrSs40|}AK1K(!BPY1qoabB*VD54=_ocs# zsZ$mGdaBco=9va!b8Oa|Vlma{N|UPFZgu>Ur`;iBNtm5P|Dq(4pnAYIiD_8zyXb9Q zitgzZ{8@0ED}XLZ*5p6^arRE;smMHWnf)G%;&m@3wD4 z$AcUNYNd(aVY-Oyo3voCH90>ETYiGA|4HV)ZtC&umpI+!g9YCZL~SLrt)Fxa(I11+ zLqE9(@$zPY!F&KpF_X@-&wx*!gTDD1{_O;+p~v|3WRv$qpB;n8bB3P|L-E_V08^;` z<=%FM$;FL>xjxSihKDhaD;1!2^+c|sZZYZ|tC=-6J6ro~NTrZQd2b5)5Zf}E^pLz{!!Hpjv!PLL;9 zkiRKz6sp%9#HXG62n+dmiqUo}Yj6rryM$;hLf?#v7Sca>F_TM^V7;}tO7^(XWKz}L zlFIG>(tZcON%(>FUN6OG>DfE5j@_vwc!*9So$)W)x)Z>M2X3+>dVjjhm7;|(iAXbW zkA!J(F*9&$&`otJ+=BYtlJ3-?nbo!%rC8}IoXc;i#9zR~lS}EH6ZyK}Cacig3*iYo0RrggkbEB)C}s2H7=#P5zA{$Wp}F7m|Ni2CCD{6JNPbus%i-52;!}FJ)P5 zzK1$jD_Sp0SDtm`neU6v@!wDr*&L?yl*Fq{UpFPyRp^y4awOdpIae&nv8a_9hRCeKTC8#w`M z&t^ z267$=Z7Kow@1Qe+Jyg_h_=U;iLvDmGK^MHQsZ|~WI#3q=P804@JvMc(>c1$gtw<_@ zuFPqiz-;WF$<>tPG(JE^YZg6BU-BEMuKE>3uP1ZNPa(1%#rKm;raXhn{1ccL_%QzN zelYR|5Rp|vlRg0N;4B+o;+U4UpGri$9 z2qS!u`LIVveWK5>Oso7m?ps%p>`NW4P?}S`2hypoB4!EXV;N>B-BX<1EX!vVB7z=? zPjH?e5#`4N?|=uCbO*p<5oRxZMDq^|A#pkf=^l5|o64UGJu&_D4c!Lk5o4}Eb4I=a z=)(2rlF8&uF9&`34Ue=K-JKooXvp~Qe#~Wg6tVvT9R$~1));K;A31se&Qu+%06eB-1XGm4F{Ey zCKM{AH8vzC;F&flUR~cM-ED{NL%B85c+&b zyDFT8GvUQFqzCQ6_?Pcv7v%$F&O(xHk*^eHU+O$)%ClzhOd|%~DpL0i%fj@(I=OS>U)8KF%helUFX6=PyAH_=A zD|_V(3*EMr)vm~nn5UVZ1}|-@F2FAkhmM10TpR zJ}U8)JDv)@ujtCrnM_wDcSzzkR(={AtKQ!OeR|eJN)aYF28U*9$qmRc@2>VNs4ixvr^^LBGX5lN=0G+!DZcZuQC8XFQE3LLr)0&B?bXI!>A8$T+ zk{9rChPWxzeH;!>Rvw(?YJBTsIicrLv5}u#!eKB&hQR529UFEKxJ*+wk@K%v>pD+% zZVi8tMU@w3evkG(eh{V4wkT!>j9S#7Z!T~e}8G<6QLBU#$pt&@fH ziBR;O9UqoP9>$K3q}RYn`1$Ah>YS=CS@pWCLwfd`ohmz>0SB?`=SS)N+cgwRW!=4pFnubv4y3Esig?_>}MEj-YE4{iAt0|TGJxwat z(^yA;^OOGQQ!FJH_l7?`@yWV{xz}Gw&}Ai{dT6FlN5wCD~zAi zkB+dX`NKfAF9zY-m;O;p&?|;Y*d)eGd`nS{(0;p)B9bylimvmDTaFhw0K zN8sWeg%!|=vHV!*urKVPMdBjY8b;HzL_u?-CVrt?%kNJhl2`1ZXesUQTUW{Kax7n5 z`QiNR%3w6|Fl^OAPT{ri7gplco`f7L!!La!Y)!clIgpKEv*&B-abET^i+6Y!_^6L7w&S#9PcoJ`jdb zZIInXB zp0$|>?yt<2;==8l93So=SSo8gRwRmy?Z~bmArm=DyF!CY=f{W)0e^l48*Gw1>YL$9eU-xIKlW$9lW9YwI~c6uO|(=O7>xUnnY@tiH^ZB;s72Gc zjB{glMRviip0j7kZiV&t+{lGwFj&uZFra_H3O|Y+?oEHx(x7?!@pE;Nko8pO9PQ`d zw=bEWZQe^bMP)cItH~C=Ol8y^yhc(jRSQ4AFKqA6$yA&iwZR^oOSZGWJ1LcEDaUCR zswF;XK)A(8ngH(hJeb9W@g8xx=v;q`yBCjS61wUQccvdmN2I}=x+jUv`@;w^BA?LB7vf5t;JcK<5?#)9Ccu(9A1~_(_}b6<*Zk?=cm2Qt2c)94kT*|f zj>9?1-23b+v8hL;IOW+?oU(*Zpobe(jd}4|8>RM8d#N2aPw21TOWnD7O(xT6rknJ3 zOS1C^FfH}m=HfTy;bfePrac)R%H#Cmu8KCS;?H(Z!J?T5(lMLvBlq|jppR{$ zq9BA%xjnEHUC?_kVF8<9kE@dVxR&f!PZ(-F(6*9ivlZJH*JSQQ=D#vy3Co^Z{3zDk zxWs4fTsm&O4ce9@Q}-g)bV=%r$r=>jc~t5yUZ0J9`P|=)#ke?{NblLmHQ|$oCa#2=)H@m&SBj5` z_rWetcXP=Q4afR?4`MvXzsGs`)Q_dMuq1Y~Y3dGTX{8PRJYSW$E<592+0TIfE|!B$ z{E|nwe_|2mco8014|;Y+VCuhe2AXm2T0#Aux|Z!oeHJ7;Z3&DoqPU|RdT0Z_LUsQb zo>XK~_PoIsWX5jNHmkumzx7LqrGKT?B+K=J1tS*1 z)?R%&+tXK$F&E>G$A{3bR8ygBKCbpH@kCCm&h< zoa||7tnoeWaO&ee1C5>vzwQ`3q)+~XC|T|#L_$GF?Hmtj%WIw9Wj%rVj|sywd_nU% z&vq5y<4vUdTW-+K{lM$rLmO1Xf*A%S2An;6CYEK{JITHBj=IvRR2MHm*A6CoSI%8X z_HGG#R-B&-Q~;2FHG@0r`&17Eo< z?=il=s&?}7cj2=ok*>AOA*<})U}xsS9a-icLxN8vpFWYy@eOzcRinw#p?DB=+~MRq z561FustME4onls5S>@VIGZiM{o=dgngRsU*P#;s7JAK1d=ZwgP$X-iIw%-bBmGsgX zm)1%nIGSrS0xYXOOv&%aJ^o1Fnws=H>rak%0+qjav39+q+o?BighVc-s(d6_Se*cA zIx(&OTKNk0F3m$VH11wE5H{i(_#rj?^S+sz0ncbOPjNL>Y^6XH#=*?&<*x@*C<7O$ zPf8x&03)r*T-0KIHnDv%bkx4=h{ej;(e*9GL?(N|XO_+j+EchjOX|kzB6|z*;j2>V z(9Arr7VE_n!whzjDlp%Jg`h2avktVc7@&x?{DORL8Xg$x(NF z!;^}$6UHOUUcI9zG+n_`9&GakW)&V9Rf0KkNz~HMb8GNz$E9j0Oup6IME1?jZW_rB zJ1xJiIE5uDooJB(a<5*6Uvab0rHuHHObENEkz`;)(xd1_X~Dt zF-ZJ!(3Zkf0tN=WP&?zChiXm9j835Rp4nTmW%ftERi@5nHo{rke+$dwZdU~PR#X-$ zC&J8ML+OL;33Uo~%ccjv@6Lj4`aN2y1Npu>)Jbhf<%oA?WRnw1l=)tr(X@A!>Bp7^ z3%dihcukOzQFska-~?`P1*q4qms(3nQ;+~#Z`G!md~mF-3-hBSr{tM zlOMX>6^CuQA9s$K<1Hrk>2?M0;v7 zlaF0L1UA4d-v?W@CVD5jk{a~ZZY(^pUPSxC0riqqv5Is3s}lC@aW|Ik?(am0!oF=m zzWps%9ZbJFHuP1d1NEa9@5%T@9m#FH?kZ!~XWz=pXPUbyu#SPkNr@pMhC{X{m8-VdvdWKXw+uBalJe$DQ}gmrw3vxem7}}3 z-+ZnSYu`7;w7eDGU}-e}AiSD`;i-L<%0Y`WYm8Zoel-!OE*|5@?i9bbUq@t6ih7v6 zk;pgk&02%&f6kgrfJ<>IQB@7_v>WOBG!0Irve_0T2EQX@VJtqA4wTOj?pR#6=J>>g z-F2+XjUc%zsK+@u@fr7354qj6KHttzVB$$G6wL+=mp@e-^O!pr_P{~(2AT*Ld?|Ky z3Gr1)cF5K&bOO^!vDhSidUEo&aPrJ@SgfPEDtTJ_lI8O7g?p!RjOFmvO1mTBoev{# zB^lKIh4})1u35sTgm@%WEX$5nB$xgi64r(3af`7jld*Nhk(lf76H0I=fi0BQU?FPW z+UE|RZqJx~?F*1~od_FX9%%Fv#0xd4tZL;Jv6GXKCGDhg5aN3aZOOdO)_(e*{a*Tt zc735O(niXBm&2mo=DKkvucQ*CC6)Wf!?E3iQ=#dHL9?6QvFljoFszR3glP+%H$_h3p{jLbVT`8U5wv4LvC9wWo`HmLRrW;b==&h{rG5TYIHa-ci2J=n1) z;LrAF+kX~zG}vlsjj*HTu|IdZ-aa49<9*;nR)Bf@rmIUP>;U#>b2}O||F+-9=H8)u zGu>f2$e4MGWeT7Lk0vwKk3Hy%r@4r^yN}{y-^JOif;5^RXI$#Pehe0bt1td?fLnjdN0`0c-M* zX|002cP{Zk8#fIF__V|>y6ZD(e z$nZH@XDOQx$&*BQjF?J#BChpF*;bTB9Qepe7wtto4z>t=uY2>*Lu*6$mtmHI`+IBy?thll#rbmXf| z4V|h8B?a;X(kD3c8aZCRjk|33WjY~UiFtN9)7~Lq?4q$ zqXDVV{h7R26p?)m(-J6Lt6Aa{I!IrF#r-}S8OdoEpbhdm&GXTY1PQdW zvF*=ldumUmcZYq9*^P#1+t*;F6ryUYIg)!$)CYEVGk3l#Lp1*;%$>(zx|ZW7*G5x_ z&AL%l{S~Lb0Uq)nrCJ)muCC9tlc&$K-4ctjGM?>no_riLJIfNQ6@j@um~8K9_@ZTb z>Ts&U*|6(`D{cF;Z}}aWR}TLY@?D-iUCi{&6RG|@ftrG6{Bpk!Y@JHfnfD@Qk>4$Q zrQNmNv9pnW;w^vbw*Mr3?(DPdv-SBpH$njx!BBh&Tx>Y@=z5=*_1pjsV^U-~bVo?h zAEhwJQ5GklEfGcu7(XXP9itE8PI2!zH&cXe#B%o{HuSkuf(0>k#QCBk1wJ5hY)Q%z;loFWxxZ+<9WS9 zhmm4TWVr}SJR6UxaB6>Sk8IU+uR#j+cax~J7S}Vh;~9!j?>Lwln`np9x*PEItEH&6SEo9wMLEiAeQkD&S|sk(^B) zL%6cBM67;KIny%e#Jxcgmymrup4{?az>+(PULAwEpPP7nLslTc zCsw6j(H!z_57UiiI-cBQER_5%du>VoW&h0djz!3H73>uL8*?4j!s#yNekPMM7=P|O z*0wS~PoE$=4cV_0o?!EThR@MEWE+LHC`!!2&uK|#h%CH05163 z{rva$Tizt|-n?`BJ?GqW&pr3t6eOrw;Muo$6yM2+`&;%eyp6Q6jF$SddJ5|>3D_*I zW4?72s|aJ*)qWoPGybX>i+|tw_#n^6|MH{6+laRcD_XK6?8g0?)u<1d^VsQoA^R(z zV_U+_C5|oCFa1(V9ECn&Bs(j1F~eC3Ul^*noSj2AXr{1#a*KMB+6F(F%XzDF(HXAN ze#}bEVdf=jEQ?=&$EI*5`~vLlu0TJvjFtNv(NEn67n;nPP!}sa{rpyGHPH*A^h$61 zQt3_xQ$rEavJJ=%R+6s)TUzj`wTe?9Qq<4jK{^#n*i?0|`eWp%0Oo4@@lW#-YfC?2 zg>*!H1!qVsM}}@^Fa2WXw13CDvf`mJJ>yR_5|Y>nBR)p7mvv~c zcd_T-K}{7J_jJar>DZpUtZ}ek<7)ME+F=JPCl6_hX@wWHf5R?eux2~^j2@yDtFbS5 zhI7TgMD~17@@5TnE_y)=_LxVJ;0Md2-LbtYeu?$6L@47cJ8&Pn89w8D@Kx+S4?>>%J2TlS+7akjma4yHW$0^Y`fOGt)1Z_LQYvK5TZ5)% z6dY|FIqQ6d}p5oW(U}S%6g@VG7 zU^C#=qp(Z54Gs4YFvOy{1C7NfYHmlWxdbV31GL|&o(GO3U<>*vGQzW(m0-uS*u8%W z?;8glin;K~>9{{%rFTSs2y3HQU~dQbQzR%DxjY5dyX zqDO=!Lp+o|o82SfoVI*OQ-Ti+Cv$@X@WZ3b8AdQJ3p+1mba0p8pVjO1%5>t?)U>>T z@#7-aD_gK0S>RYX!_EErTezR<1*~7kQG|BnsCq3s zEuyu5_RZO@MqO#LJNjFZ?C{R3msW~_vt&<;iuwUskntc(l3SlPTQ*DjLU9ozB( zAC)jz-BK8>b9a+C?LgB-c~T03K)Nj`bV5282n8P`hai)#9!fw{xElyNP)Jkyz@aI*-_r`U z5iY%e_5W0OhH`ePLenQ}dCzhRO|`J46mx>%=*#cMo_z)@{B5i~W}_V)hmGfMq{~++ z=g)W(T0m(A(fbKPyi~>_Xz1 ziY-Si^1U7EtwJIyqmRmYss(=*m=58!R99Xo>$Jfj!nx*U+e2npY5+{P)s{TeZ39V8E9QGycm)HpI zWtK4*UbURHIUhz3on{oA?+5DCjeI$t)rd#2OnDa_Ml3BSET*mGD{OuLQ!hnIjHGQ! zkr8Jh@88L}c0V)I>)>>o{pz3C1ssGl{}k9TM6Jcs(HbnSTEPVynw|tGLOE&i#B?KY zQpgR$jw=F5G>ur5^uXDqv5GN1Ox?}dsM9#>v<{ASD|$9NCt;087c_wrPH#mztU>ZL zBF%{19?JUd$#PO!*v)%&NM~vE_aJC>Ed1?e)vN3{xso28fjwp}9!gd*>Q2`tp(U8j z%IjzNYttdYy^Ia%HYq^L!~W<9vxZRgR+9QMDB)T9a{{H$R+;Eiv9CbvIRE9+{Qu~6 zK`-J`WYlQ5X$4$$CYG%m(FFP-5#B>hIiWyn#22NVotMvQrl`N2aY zL)*jYDRDMb3oUpKTwoUMxQKMFW{vd;_DN>Ydw3c~lXJ7?&zc?VXq!b#?&57Sa@hS) z^b+{-g>Z+eAeaeRPHo2$dmgI~o3VfhWk$4{Q`nwk4)+whjGLqu zDUEY8&SpMdjjp5tDf9uTr2|}Ulyl34d&Pp~zkI&8$XVEego4va;8F>3M=|$19}Im7 z?aRgNMDNC{!ZiF|f5Tk*pmr_u`0aQ)-9w22!NThpN5`^4QjDahoDS)>Yf$QT{I{S9 zg#u%t^IT%uu_>NFI@hY6p#4Xx@4!xP8ao({(!#Nv>+%eeX*_&zk~$bZwwhT^Gnk)8 zOBs;N+%{;(=k%ZQMzQRVq(_Rtg*HwzyM}#AyYPA$s>Zq)jq)BiK_q*VjPUU{(FjbJ zaaNpu(1d)Hz$`@QVNZ{`1uqp|BgDC(S@i5s#>N>?z_r-0?PdKU70LN}*17^TMV$XP zN;3$~`WN(CMaXD>0P`AXVd2TuEtCA()>NdTNbt+X7(D^0>PBo{k3wgYk=`Fx??oH& zBs-VRQl9B6FQy-fozvMd%w|Rh!Uuy~rrLO7k{e zFLK!zE>5x@%{=IGbtd%xJMy+Ok_azLzb0=*G86t=66DdP3hM8q#dl&sGfI6sCq0Zq z+J2X{+Hj^rFQPfFR39SmLM(^xrf$ z)@zDan^(1$zx0^oKqg*>#PUbN)DYHz9nu$gfxLkg_aoZ3ISHd1Uqr&s#24z{p%qra zw{L(xCcz6vFghro;goFz9I%;|oCqIlN3%K~eas3pa1X%czr^>=aAta&)%(~f7lLLi z7WUkP?zN51RekLx*oa0~c) zkbM}#)z{&5egZzx>KLz6q(#yL(sR&37f6G+nxY zJ@n!P#ryEV^*&=uIP&ipwI8SO-ay`GQ>QXyhEyaKu}kcKN{9bm{5X^P>9&9(8;V`S ziE!FVIQ?Ys?FumUUe1LOCkelY#qT%hDnrrUSE$cL=6#Tze+Jg-W~0YnjXmV~SV1SD zM-v*;WO&G<@S0wvqk85;;{4SlWW)dMXL}3IBXqaQX}99k_Cd_8>lw`^Ax8=sP?6}? z&~h7TyKPus9b`=@LTyzyG0$7Uc)AS=-^>3tW)aI-H7Zqyst!ZD8;}KiX!ln5h8-Er zihOE@-h_X5F&jVGm@E3u?ORLu5;H=jiX=0Faoc?ABkAe@q{oBEzPl*j4n9vJWxc@IbcpkIe;}1m z?4{#bfl7w&X0m57k9BGb-+9!x1dabxR#=_~OM2KXG+4V4HEF%HOxldzVJoxTMN)$l zrF{*)IvOqGK2H9ahr~RKwYR4k5$7S#4wW`aN4*L-|Fw(Hxn5OX5z_0@jnXJd&5o$C zc%$E`xt3VnXprvZgt0v4s*h^Flwz5sSfqIEcj$XAWA=Jfvzgsyfy~t|VXhWN`FGGB zmxJR@xbp}wG@p?+UgmATW~@D3di%c~Ud(KjIfTIjAH`Ym)8Gk9;S9GiUOxdYy@^KX zJ1|KP29={dor{k58FXz$oIw7V)|<7nwc58h8F;jGG5vnKv|hSGYLhZq&Ab^On}K)) zT*qqFd92N>(rjatwlX$v)qW(!Nag5Knx$IiCf_q_x&$rq5iIBH*vq(8$amoO`;2Z6 zG4r~O6DNMp|9bf&o^N7Qy^+s4o&@Aps8gKrdpk3rJCRu*lqu;D)=x&p{~mbW0ak{G zfQjqbQS%17gFeP`c^8`Z3-CV|#=6ToXu-mmz8{O08yLUmKW>$Bz^T&bS`iN#Da!(9;j&(>>W$GwwhTdad`ZRof3+=FudBalV znVHBoO~}&jIi=WDD&&KcajSn1=J(Iz#GEx7xv&z6rJ1r#XLavF+F}(Y-UJ8y6FlrM zs#jT;{{bCKCcQTmE_?^GjW0BMu&xE!=zPr*_{m~q$Tn7p@~{^94ESB>NM@-US-pr> zYgzkylXP}~#iA{)mZh{#`c!a}!Q`J!IfSS0|L*g~|2@6^?@3kRSz?Zwz*t~IH#Cf~ zSd5>G7%6@S_B@C^9cNxMU-UyCQ3x)ygF73TF}}+QVTsHX#>0u0G9s;G#&8q6L@ot~ z&S9>R$a=x+tO8xjY4?qclOc?&uaeppIL>OY^CBet4#pw}8m1QJ48x$P!DwE@*{AtP z0=eK*CZ$S)%2SxTn~|oHkkyiSPUU?jaAid)pBQDt9SU!0CN&4CcDS@tE6_A;AkXb+ znO;TP{}l?cKvrPPl&FZ)zK0>BjAtg?sb0i7+D-7u-RK~_u@q>OIolp~IA*XiA@ooO zC4a`)Mrnq0J|p^axN|2wx`4fuZ)op8hgg6Qlt<88)nOHM2usduiXBXp1Y6pw5S8XQ5R)m+?ZJkUk79Sp{z^qE~XMtFS>3ZIH|- z#p9C-B!iX^r??jpz7pANDD>C_r=5r$VLM!RK5e}mA8Tvi>ziqdN16ZcMWT5ZO~X;N zyFRRu=;_@QbOQP6L0Eu{VEzAG^l%H%b>7IVNJvZHBhwTi@Afe2Y{8q}M~qbQj6H+d z8Q+35)68tK3TY%33(gPG^xut4GmDWR4L>!9kU};w&+cTjtKyUegW4Az|3~nXedv%M zgQMI*+14;mTngs(z+opd{}MCHT5z%$Y{;gbX2y#+q&;yin((M9_Sy)WGi9Htvc4%a zYGNf@SRgCA9mLL7vHx87RgMAAlSnC>6pKk&SaUR!(-hjiTR!D}Ib~P_hTbD{&E3d> zZ(*V7gSFY#>^UpDb2|11b-p4(|^>22%obxw6Xcg>mO zoEl!!)zRUc(%atE2R`}H!_NmU!DNa*&TjzAAMzzw^G_tAK^b1#h@wjoS z{NjAef)3T_&i3BnwH5hgHBF7l7i) zxriDmZAfZB$v_5)q(q@;B6mnv@kDuCwUaXyDT{{Wr7L$LDv68I(iL(dL=k@k69rPL z&t2pqhZm^;B5@I`FH^Y;B0J!6U+^rNT24Yd%XROo3*`{a#h(Ds@S><9Q*u#?Ey^i3 zmt0?x5_RO6^j%>nv#5)LHUj^YXStjtBrrrSo=8wsM{Yn7K@?uJubh+!Bf3iDO$7-l zvY_m8fDCAq)~=1^26fU5<_oCfDx&X+_44v>zF zW3B|1WW~2gNNE{SFgYWBDorY*qG%i5$XUArh_;doKs|Vt!;3dcFcDX7Mv<3@EWVU7 zh%OPK$yY=pbCIL?6K@D3f)Snoz~wAN2sxH`t2BjD9yzcQp19(V_j1?U?ad++au*rN zG-z)oq<9upRtl`V7r{jLDHRuaiDbr$x70yIlB1kqM)U#gPx~lc>*_hVFGVYhMpXKh z4nD(-6m%4gC1a%cDahgsGdjbJU}(RZ8R@k6tMZnFJqeyebTRs{NMpPyE<7qM!klbN zvxzI(EZ^iWb6TR#Z0!4Ow3&@jamL83G_xTg#siRMG$@h#g7!ZcjagapFC&-xwb3Z& zVoWaPlE04m7H{P%-TmMW)&KjSK6%9br(w?o_!qZ;yQBZR?qGV~--&9j0Q(^3fmd9d z`Ix^*`L_s_lG^`lHYX=Xrtvb(oZ^`RQAKnC)(bFKN@|=rGC7%Gx-|Kfc#)E1HW*@~ zb%qpkY@{wSHcV$Q#pnWc{yIZ+l+I)@MClAs;YmqJ`WS;DT(6Ic255*fMCo;Su?Fhv zFX?nzp9q~K`LHi6Alz3Q6{QQ1bm4(IosNx}8f_$(e@JjhghtYO2WTbl$WUE?TEdT- zuUe}OR0k033^V!{6Wy8QPTT^01ovO{(8q~*IMH>68F?@x{fKIZP&6qjrRv(&dHK1s zyC$FHH9Er}bjtbY0~^tr3M+tH(R^=5JNYK79zSy8r~%t03swLP>Iqn?%vb*gZSfjx zg14}yy^9s2cUUj^2WLQqX-t|NR+?(iACJe1t{dCw%Q+=&J^Q|%z`Ff4Z0SG8SBW3~ zER5J-55iZ>7*?M;*!Qsv&!_9rBtM|tfnE0Bu=e{{`yD#xNXaB+OC{{58!1hYrb*pc zu3RSFAl)Y2i;c_E(hJgS()-d^($8MOUa?+jUN)}^uVG%ztQ~iF>B~wbJVbuMJ-J zc|GFwjMo9Lcf3CJ`rg~eTjy=`&h#$yuJvy8KG(b5yT|(??<>8p_uk-rulJw4pYndm z`%UkUy}$L*`ULyL`K0<3_*D6vBWJIS}hccJf6->ZDr`rhGtzwdV6-M;&M-}U{w?{|J)eqnxb zep!A+es;eGzq9?O`JLx?q2Hx`tNqsd-R1X)-%h_5{9gAv?Dqu@@%;TG{S*Cj{7d|6 z{hR#H@t@(}>%Z9lxBl1r-{ya>|2F?;{9p2a+y5i~Zv&)&kbszg)BsyRWx%k2(E)7% zT>%RMmISN}SR1e@U~9l*0lNcU4mcR_Nx-*(UV)*3v4N?9`GHk|X9bQ9oD?`Ka6#ab zz?Fe(12+ZUAGkemci_u`2LnG2{5D7%6dDv4lpa(NR26hq(Ac2KL34r@1uYL+6?9Y3 z=AZ|Hb_6{i^h(g7pwEMT2=)us1sj7igNuTzgBya!2Tu*|4!$t>^5E6Mw*=o6{7~?d z!7l{A7W{tjm%%@U_=o625<_xAN<)T(G=)qInI6&;a#6@{L)L`c8gfs_BOyu#B*xFnd^i*tjrf*qpEn!!8e79kxE~uCRy0o(g**?2WJw!oCdqIXo~tDm*1T zFT53}Ex)NQjZlrF4Zn~~V zcd_nD-SxWLboc4D>7LcSsC!HIq3&p;CNelOCNeeB7Fij2R^*t-$&sCr3nQ0DUK6=4 za&zQ^k&j32iQFG~DDv~jAN78Eo!+R=))(t*^iBGS`sw;!{bK!<`s?+#>hID2NxxJ7 zSN$9M5B1+fX`@1-;-b={3Zn)`)klqsni@4H>Vl}tqE<)U5_MP9!%;hPXbr z28|)eU@#;bEQT^eouS3xFw8P6G%Ph-W4PIHhv7lPd9lBV zT@kxB_V(EOV|T>vj@=)7DE711@8f*pBH~PO*>NRtHE~UG6XRyY&5gSxZbjS;aU0{d z#Qiz$xwx0(-iiBr-1qT5@e%RH`0V(S_}chU@#nw}bYkJ9a(DbS4`$V6_h(u#zc4A3lZQ`gzN8+r+`H4#t zuSvW)@ehd)Cq9+9FY(R9j}pI0l9Ixb;*&Cyij!)RMkY;2nvpa&>5`-sNo$jCPkJ!v ziKM?Iy_R%1>1(sf9Au6$r<)7Rc5|b7f_a9y*L;b2rFpG+llgx0cJuS*1LhCRUnQ%P zgOg*E(~=94?a7VF6Ov~n&rQB0d1dmA$(xh^nEX`o3(0RJf0%qUMVk_u5}%TpQj#(> zr8&isGCO5q%JP(JQ*KGQJLQp-XHxd1yp{5C%6F+gsgbEksg~4=)U#5@rcO=mPQ5tw z%GB#qH>Pe)-I2N{^|jQ)sYlbaX`yKeX<2C{X+zUm(%RCx(iWv%mbNBsL)wSwl3S8ZOa~<-IzTwduH~+>`Sw+%ifs%VD?kl`?3#af13SMPEbyKPF7B7 z&aj-ZInJE9IZJY`$+;!xo}6ttdvadS`7r0(T;E)MZc1)JZcT1;?&RD#xr=kJ&b=x3 zuH0?8yK@iZ9?AVS&o3_~FD2FtmYPRm7>m6n?=_gMaH*=u>r@`>d~YoOI=&9hcm8?EPBXIn3}uC%VVZm~XT zeaU*r`jySwrbi`GY#VMn+ty)QWLsgo#dfc4hwZPnw{4&0Yx8ya$@zu(!}7=Hx92a) zzasyZ{4M#9=kLq^Ape^J|AOd(oPw%?rh>@@a|)Ih+)%K&;L(CT1#c95Q|MC|TbNxq zxUji!TH*Y{D++HeysvO);VXq775-EdR+L;+Tr|AsoT52JmlfSubXU=nMf;166#ZDN zFU~BkC~hg9QG9;!HN_i>|5UuU_;87;L|2klQd-hlGOgs2l50yglssGVTFIxSfu*sf zC8hPHQ%aYWt}ESI`c&yVrQZ$;9+W<4_@D`c77kiH=$=8l2faJ!A7wFRIb~I4-DS(l z?kan{?7gxd$|K4Lm5(i7SiZXa&hnSbKdp$Z7+f)`;^K;{Dt=$Fv*Nub$D!t2UpJjLt|#XC$LDlF=E-=!|4^Mlw1h8J&@g+>%jg zQO;OrM~BMV)9a{i>v1X%_Ld=z+D5wrd#1UVVYPQoR}D08Qk7RNnB8HT=j`sm7_1`6 znrlg_s`M|%a4e^xYwFw%XU_1>p58W$xGKvV+h#i}2c}S-C%-Nqqa;yjE6;O3mNz(i zXLL=?IYGSgJWrTApgW?q5A1$ZUeh&uwzIRha(L%Vm*HA(`)sGF!c=1FaZd3UhHkDG zg;tA2yerRh$0=`W>!#?vl(4e@xw5>qYnHRKvbM%i(>ABH$T76NqoX`ed09TDtz)jU z(pp?%u}~rTM|oafI=__6kfs)gy}8EGGNgX!z~oLnt)_1097iiv9FRoOX_TjBN?V81 zQQJPRy{D^tKsvVEQ!h(x*ZfXLOWW)@9Ro{4N1bBZ)Pt4Xj;5~pe787zdqKv5B`Q3P zA~m--s@pp|NyX9B)=STJ4oK~k3r0%V4uSza|AQ22T58*R+kRC7Bj-6g9j(sUbDZ66 zy>q(sbeh(c(g|?ST5^ho=_AsUl_$6Gl>4VYtrL`} zfHZ8iwRpOB{1Bne1_%H`IGXb?)RT zbGVtTxwfn#TOot4CC5@=QXXynkNG*4eAnB;9E-&ldB;?Zm?ME{v+YBgdSyFx;j&NI ztK(?IK96rM7fft1IUd$Dw2>eh%<@H?XxIN@?kaoJxG~(+82QWT@vN~40GGX~Tf}q2 z-0^O3!H$b(6#y>cjpHUZ2aslXzVgpTF#&6CRninr>O>fod>0^oS%6AO4<*S8YAMJ$(xVqz`s%nr>K4YYRct zuJ(-OnSaAAwKNk@uLVMNGE2n2(DmsD=xeXFM-n z(Y9m$>H%}pyBqeh2Tbe2T{rAC512Fn_O=T)misYv(8LLdTowU4hE_BsGDwtDz+CvE zw2MYi50?w(!WS28x&j;0G^Up);Y>!<*u^Ij3j}n?m`0_ol{O3H6@4;BrfC<+DpDnllWDMFWUVr;DEQ*)qj6DkypgpE|5SJ+-Jz0%DT{zL+Q%qu?O7I4A_1#E zLH#DlAXVeY;Y$4k*HXqe-0Y4^7tkg~b8ar2kX8U*0ZgVA7tH0V)eW1tQ;t_NQmLO@ zPB*Nr*#kBpp7SjkR@>lNcTwjkl{B-%1Lmd`H*ARvs~=gz-PM00Kff5_t@VJp=-mzL zc|eA>oUQcxF@2<(B*R+AEB&X)8Ulyl-52~thK;MQ<~|V5v;x*#*QoGMC7v?INf*fc zthw%(vC%+q18K^2Z*DkVwy}x?xtbfMD($JH>B5N%zH!0EaCg&~z#)xCJP+B%7yiP( zbfHWS&Bw}1t~8hF- z2&V8)#W|v!pI?b0Op%{}38(*k@dC1y+Ph%l_?SMJe?+P%rYNU~C)_6W!2+^fu(n<& zFgO1c^`gy|rEpg@JLh@enOt|7W@XsiPR~9PiKP-xE=)^aqloY3FCtHHY1vp2ucgMW z#5)EDtL-wZVMr}^H}47JIf!_IPpeuQ>U%w4E*`l|rj?e4rg{&U3(uDI$nl!&N*xq> zm)p}mr4*VWO$FwrF?X6*dccH(xV|>)i#KM7plx?K1zghR=gNGkMS%@WbCsN?0&|aX z*}Ti9ezMFi)Mav-9{CLxk+^_$a&xz*sDnmnF_o%ybhSd$3jY)|snt}MasxJdPB*uK zbXzW9qtS@TFeRRgZkO#8usJjAO8q>_vVF0D2w2T9Ztl8!@k~!H`-=jr9q$2C+GTS4 qbOkm_=_5~mJw-r7nypHH3QXXb^fQ+SOdNUK*AMQp2>5@>_5T3mZxOWs literal 0 HcmV?d00001 From e924815e1d5f54cf870c10f7e8dc206fa741ed7f Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Sat, 5 May 2018 21:43:05 +0200 Subject: [PATCH 03/37] ABITracer Constructor with URL --- .../nbio/core/sequence/io/ABITrace.java | 24 +++++++++++++++++++ .../nbio/core/sequence/io/ABITracerTest.java | 18 +++++++++++--- 2 files changed, 39 insertions(+), 3 deletions(-) diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java index 509aa8a75a..d54c6cf78f 100644 --- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java @@ -32,6 +32,8 @@ import java.awt.Color; import java.awt.Graphics2D; import java.awt.image.BufferedImage; +import java.net.URL; +import java.io.InputStream; import org.biojava.nbio.core.sequence.compound.DNACompoundSet; import org.biojava.nbio.core.sequence.compound.NucleotideCompound; @@ -96,6 +98,28 @@ public ABITrace(File ABIFile) throws IOException { initData(bytes); } + /** + * The URL constructor opens an ABI file from any URL. + * @param ABIFile is a java.net.URL for an ABI trace file. + * @throws IOException if there is a problem reading from the URL. + * @throws IllegalArgumentException if the URL does not contain a valid ABI file. + */ + public ABITrace( URL ABIFile ) throws IOException + { + byte[] bytes = null; + ByteArrayOutputStream baos = new ByteArrayOutputStream(); + InputStream is = ABIFile.openStream(); + BufferedInputStream bis = new BufferedInputStream(is); + int b; + while ((b = bis.read()) >= 0) + { + baos.write(b); + } + bis.close(); is.close(); baos.close(); + bytes = baos.toByteArray(); + initData(bytes); + } + /** * The byte[] constructor parses an ABI file represented as a byte array. * diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java index 96a89d9ad8..bad847a68a 100644 --- a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java +++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java @@ -22,6 +22,7 @@ package org.biojava.nbio.core.sequence.io; import java.io.File; +import java.net.URL; import org.junit.*; import org.slf4j.Logger; import org.slf4j.LoggerFactory; @@ -50,12 +51,23 @@ public void tearDown() { } /** - * Test of process method, of class ABITracer. + * Test of local method, of class ABITracer. */ @Test - public void testProcess() throws Exception { - logger.info("process"); + public void testURL() throws Exception { + URL url = new URL("https://github.com/biopython/biopython/blob/master/Tests/Abi/3730.ab1"); + Assert.assertNotNull(url); + ABITrace tracer = new ABITrace(url); + Assert.assertNotNull(tracer); + } + + /** + * Test of local method, of class ABITracer. + */ + @Test + public void testLocal() throws Exception { File file = new File("/3730.ab1"); + Assert.assertNotNull(file); ABITrace tracer = new ABITrace(file); Assert.assertNotNull(tracer); } From 9ecbbe0b156691416548a84bdc249fcf9d31dc7a Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Sun, 6 May 2018 12:25:55 +0200 Subject: [PATCH 04/37] Tests ABITracerTest now running --- .../biojava/nbio/core/sequence/io/ABITrace.java | 6 ++---- .../nbio/core/sequence/io/ABITracerTest.java | 14 +++++++------- 2 files changed, 9 insertions(+), 11 deletions(-) diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java index d54c6cf78f..927ada2b4b 100644 --- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java @@ -91,9 +91,7 @@ public ABITrace(File ABIFile) throws IOException { while ((b = bis.read()) >= 0) { baos.write(b); } - bis.close(); - fis.close(); - baos.close(); + bis.close(); fis.close(); baos.close(); bytes = baos.toByteArray(); initData(bytes); } @@ -533,7 +531,7 @@ private boolean isABI() { return true; } else { for (int i = 128; i <= 130; i++) { - ABI[i] = (char) TraceData[i]; + ABI[i-128] = (char) TraceData[i]; } if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) { MacJunk = 128; diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java index bad847a68a..b97981abec 100644 --- a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java +++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java @@ -24,12 +24,10 @@ import java.io.File; import java.net.URL; import org.junit.*; -import org.slf4j.Logger; -import org.slf4j.LoggerFactory; public class ABITracerTest { - private final static Logger logger = LoggerFactory.getLogger(ABITracerTest.class); + private String filePath = System.getProperty("user.dir") + "/src/test/resources/3730.ab1"; public ABITracerTest() { } @@ -51,22 +49,24 @@ public void tearDown() { } /** - * Test of local method, of class ABITracer. + * Test of URL method, of class ABITracer. */ @Test public void testURL() throws Exception { - URL url = new URL("https://github.com/biopython/biopython/blob/master/Tests/Abi/3730.ab1"); + File file = new File(filePath); + Assert.assertNotNull(file); + URL url = file.toURI().toURL(); Assert.assertNotNull(url); ABITrace tracer = new ABITrace(url); Assert.assertNotNull(tracer); } /** - * Test of local method, of class ABITracer. + * Test of Local file method, of class ABITracer. */ @Test public void testLocal() throws Exception { - File file = new File("/3730.ab1"); + File file = new File(filePath); Assert.assertNotNull(file); ABITrace tracer = new ABITrace(file); Assert.assertNotNull(tracer); From e30cc52d6b8e357580705dcffa6078f76d280e09 Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Sun, 6 May 2018 14:58:02 +0200 Subject: [PATCH 05/37] New ABITracer class with ABITracerTest and new ABITracerCompoundSet --- .../compound/ABITracerCompoundSet.java | 65 +++++++++++++++++++ .../nbio/core/sequence/io/ABITrace.java | 27 +++++++- .../nbio/core/sequence/io/ABITracerTest.java | 23 +++++++ 3 files changed, 114 insertions(+), 1 deletion(-) create mode 100644 biojava-core/src/main/java/org/biojava/nbio/core/sequence/compound/ABITracerCompoundSet.java diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/compound/ABITracerCompoundSet.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/compound/ABITracerCompoundSet.java new file mode 100644 index 0000000000..078c524515 --- /dev/null +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/compound/ABITracerCompoundSet.java @@ -0,0 +1,65 @@ +/* + * BioJava development code + * + * This code may be freely distributed and modified under the + * terms of the GNU Lesser General Public Licence. This should + * be distributed with the code. If you do not have a copy, + * see: + * + * http://www.gnu.org/copyleft/lesser.html + * + * Copyright for this code is held jointly by the individual + * authors. These should be listed in @author doc comments. + * + * For more information on the BioJava project and its aims, + * or to join the biojava-l mailing list, visit the home page + * at: + * + * http://www.biojava.org/ + * + * Created on 05-06-2018 + */ + +package org.biojava.nbio.core.sequence.compound; + +import org.biojava.nbio.core.sequence.template.AbstractNucleotideCompoundSet; + +/** + * @author Maximilian Greil + */ +public class ABITracerCompoundSet extends AbstractNucleotideCompoundSet { + + private static class InitaliseOnDemand { + public static final ABITracerCompoundSet INSTANCE = new ABITracerCompoundSet(); + } + + public static ABITracerCompoundSet getABITracerCompoundSet() { + return InitaliseOnDemand.INSTANCE; + } + + public ABITracerCompoundSet() { + addNucleotideCompound("A", "T"); + addNucleotideCompound("T", "A"); + addNucleotideCompound("G", "C"); + addNucleotideCompound("C", "G"); + addNucleotideCompound("N", "N"); + addNucleotideCompound("K", "K"); + addNucleotideCompound("Y", "Y"); + addNucleotideCompound("R", "R"); + addNucleotideCompound("-", "-"); + } + + @Override + public NucleotideCompound newNucleotideCompound(String base, String complement, String... equivalents) { + if(equivalents.length == 0) { + return new NucleotideCompound(base, this, complement); + } + else { + NucleotideCompound[] compounds = new NucleotideCompound[equivalents.length]; + for(int i=0; i getSequence() throws CompoundNotFoundException { try { - DNASequenceCreator creator = new DNASequenceCreator(DNACompoundSet.getDNACompoundSet()); + DNASequenceCreator creator = new DNASequenceCreator(ABITracerCompoundSet.getABITracerCompoundSet()); return creator.getSequence(sequence, 0); } catch (Exception e) { // this should be impossible! @@ -170,6 +171,30 @@ public AbstractSequence getSequence() throws CompoundNotFoun } } + /** + * Returns one of the four traces - all of the y-coordinate values, + * each of which correspond to a single x-coordinate relative to the + * position in the array, so that if element 4 in the array is 972, then + * x is 4 and y is 972 for that point. + * + * @param base the DNA String to retrieve the trace values for + * @return an array of ints giving the entire trace for that base + * @throws CompoundNotFoundException if the base is not valid + */ + public int[] getTrace (String base) throws CompoundNotFoundException { + if (base.equals("A")) { + return A; + } else if (base.equals("C")) { + return C; + } else if (base.equals("G")) { + return G; + } else if (base.equals("T")) { + return T; + } else { + throw new CompoundNotFoundException("Don't know base: " + base); + } + } + /** * Returns a BufferedImage that represents the entire trace. The height can be set precisely in * pixels, the width in pixels is determined by the scaling factor times the number diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java index b97981abec..6604199f81 100644 --- a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java +++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java @@ -21,13 +21,21 @@ package org.biojava.nbio.core.sequence.io; +import java.awt.image.BufferedImage; import java.io.File; import java.net.URL; import org.junit.*; +/** + * Test file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/3730.ab1 + * The test data for comparing the results from ABITracer for file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/test_data + */ public class ABITracerTest { private String filePath = System.getProperty("user.dir") + "/src/test/resources/3730.ab1"; + private String sequence = "GGGCGAGCKYYAYATTTTGGCAAGAATTGAGCTCTATGGCCACAACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGGGCGGCAGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAARACCCGCGCCGAGGTGAARTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAAGGGGCAYCGCACCTTTC"; + private int[] qual = {20, 3, 4, 4, 4, 6, 4, 4, 0, 0, 0, 6, 0, 10, 20, 26, 22, 17, 21, 31, 29, 32, 28, 18, 23, 17, 19, 35, 36, 50, 39, 50, 50, 50, 50, 50, 25, 35, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 39, 33, 20, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 50, 35, 31, 23, 28, 31, 21, 43, 39, 35, 24, 30, 26, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 39, 31, 24, 39, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 43, 43, 50, 50, 50, 50, 50, 31, 31, 31, 31, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 35, 50, 50, 50, 50, 31, 36, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 37, 38, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 35, 35, 36, 36, 21, 39, 35, 35, 35, 39, 35, 37, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 35, 28, 28, 35, 35, 35, 36, 36, 22, 39, 35, 35, 35, 35, 35, 35, 37, 38, 28, 35, 21, 36, 36, 37, 35, 35, 20, 39, 39, 35, 35, 35, 35, 37, 38, 28, 35, 37, 34, 35, 24, 24, 27, 25, 20, 24, 37, 35, 27, 21, 20, 21, 27, 17, 20, 24, 32, 26, 20, 12, 20, 10, 20, 24, 25, 23, 20, 32, 24, 24, 23, 20, 24, 23, 18, 34, 34, 34, 22, 26, 24, 24, 18, 22, 22, 23, 25, 20, 12, 20, 24, 23, 24, 23, 22, 20, 20, 0, 20, 24, 23, 20, 8, 10, 4, 20, 20, 3, 7, 19, 20, 4, 4, 7, 7, 0, 7, 11, 18, 8, 3, 23, 23, 20, 11, 4, 20, 18, 12, 20, 20, 20, 4, 20, 4, 2, 3, 21, 21, 21, 21, 10, 15, 14, 15, 19, 2, 4, 3, 6, 11, 3, 4, 6, 21, 16, 20, 11, 1, 4, 12, 0, 15, 8, 1, 3, 3, 12, 1, 11, 20, 4}; + private int[] base = {2, 13, 38, 51, 67, 78, 92, 118, 138, 162, 181, 191, 210, 222, 239, 253, 266, 280, 288, 304, 317, 333, 347, 359, 375, 386, 394, 406, 418, 433, 444, 457, 472, 482, 496, 506, 519, 529, 544, 557, 569, 579, 590, 601, 614, 626, 638, 649, 663, 673, 686, 706, 715, 731, 740, 753, 765, 777, 787, 799, 813, 826, 838, 854, 863, 876, 892, 901, 913, 929, 937, 948, 960, 970, 981, 993, 1004, 1017, 1034, 1045, 1056, 1068, 1080, 1091, 1103, 1115, 1126, 1138, 1148, 1160, 1177, 1187, 1199, 1211, 1222, 1232, 1243, 1254, 1268, 1279, 1294, 1307, 1319, 1330, 1341, 1352, 1362, 1374, 1388, 1398, 1411, 1422, 1433, 1444, 1456, 1466, 1479, 1497, 1506, 1519, 1531, 1543, 1556, 1567, 1578, 1589, 1604, 1614, 1630, 1641, 1651, 1662, 1675, 1688, 1700, 1711, 1721, 1732, 1748, 1758, 1772, 1784, 1795, 1806, 1820, 1830, 1844, 1855, 1866, 1877, 1892, 1902, 1914, 1926, 1939, 1950, 1965, 1974, 1986, 1999, 2011, 2023, 2037, 2047, 2059, 2072, 2084, 2096, 2107, 2120, 2132, 2144, 2156, 2169, 2180, 2191, 2202, 2217, 2227, 2239, 2251, 2264, 2275, 2286, 2297, 2309, 2321, 2332, 2347, 2358, 2369, 2381, 2394, 2406, 2417, 2429, 2439, 2452, 2465, 2476, 2490, 2501, 2512, 2524, 2536, 2546, 2560, 2570, 2581, 2593, 2605, 2616, 2628, 2640, 2653, 2664, 2676, 2688, 2700, 2712, 2723, 2735, 2748, 2759, 2772, 2784, 2795, 2808, 2820, 2831, 2842, 2854, 2866, 2878, 2888, 2901, 2913, 2927, 2936, 2947, 2958, 2970, 2982, 2994, 3005, 3019, 3030, 3041, 3053, 3064, 3077, 3088, 3099, 3110, 3123, 3135, 3146, 3157, 3168, 3179, 3192, 3203, 3214, 3226, 3238, 3251, 3263, 3275, 3286, 3297, 3308, 3320, 3331, 3344, 3356, 3368, 3380, 3391, 3402, 3415, 3426, 3440, 3451, 3462, 3474, 3485, 3496, 3508, 3520, 3532, 3543, 3556, 3569, 3580, 3593, 3604, 3615, 3626, 3638, 3650, 3661, 3673, 3684, 3698, 3709, 3721, 3732, 3744, 3756, 3767, 3779, 3792, 3803, 3814, 3827, 3838, 3850, 3862, 3873, 3885, 3897, 3909, 3920, 3932, 3943, 3955, 3966, 3980, 3990, 4002, 4014, 4026, 4038, 4050, 4061, 4072, 4083, 4095, 4107, 4119, 4131, 4143, 4156, 4167, 4179, 4191, 4203, 4215, 4227, 4238, 4252, 4262, 4274, 4287, 4298, 4310, 4321, 4333, 4345, 4356, 4370, 4381, 4393, 4406, 4417, 4428, 4440, 4453, 4464, 4477, 4489, 4500, 4513, 4524, 4536, 4548, 4560, 4573, 4583, 4595, 4607, 4620, 4631, 4645, 4655, 4667, 4679, 4690, 4702, 4714, 4728, 4739, 4750, 4762, 4774, 4786, 4798, 4810, 4821, 4833, 4845, 4857, 4869, 4880, 4892, 4905, 4916, 4927, 4940, 4952, 4963, 4977, 4988, 5000, 5012, 5023, 5034, 5045, 5057, 5069, 5081, 5093, 5104, 5115, 5127, 5139, 5151, 5163, 5176, 5188, 5199, 5211, 5223, 5235, 5247, 5259, 5272, 5283, 5296, 5308, 5320, 5331, 5343, 5354, 5366, 5378, 5390, 5402, 5414, 5426, 5438, 5450, 5462, 5474, 5486, 5497, 5510, 5521, 5532, 5544, 5557, 5569, 5581, 5592, 5604, 5617, 5629, 5641, 5652, 5663, 5676, 5687, 5699, 5712, 5724, 5735, 5748, 5760, 5771, 5784, 5794, 5806, 5817, 5829, 5841, 5853, 5866, 5879, 5891, 5903, 5916, 5928, 5941, 5952, 5964, 5976, 5988, 6000, 6012, 6024, 6036, 6048, 6060, 6072, 6085, 6096, 6109, 6121, 6133, 6146, 6157, 6168, 6180, 6192, 6203, 6215, 6227, 6239, 6251, 6265, 6276, 6289, 6302, 6313, 6325, 6337, 6349, 6361, 6374, 6386, 6398, 6410, 6422, 6436, 6448, 6459, 6471, 6483, 6495, 6507, 6520, 6532, 6545, 6555, 6567, 6579, 6591, 6603, 6615, 6627, 6640, 6652, 6664, 6676, 6688, 6700, 6713, 6726, 6738, 6749, 6761, 6774, 6786, 6799, 6811, 6823, 6835, 6848, 6859, 6871, 6883, 6895, 6907, 6920, 6933, 6945, 6956, 6968, 6980, 6992, 7005, 7016, 7030, 7042, 7053, 7066, 7079, 7091, 7104, 7115, 7128, 7140, 7152, 7163, 7175, 7187, 7200, 7212, 7224, 7235, 7248, 7260, 7272, 7285, 7297, 7309, 7321, 7333, 7345, 7358, 7370, 7382, 7394, 7406, 7419, 7431, 7443, 7455, 7468, 7480, 7492, 7505, 7517, 7530, 7542, 7554, 7566, 7578, 7591, 7603, 7615, 7628, 7640, 7653, 7666, 7677, 7690, 7702, 7714, 7727, 7738, 7750, 7762, 7775, 7786, 7799, 7812, 7823, 7836, 7848, 7859, 7871, 7884, 7896, 7909, 7921, 7933, 7946, 7958, 7971, 7984, 7996, 8007, 8019, 8032, 8044, 8056, 8069, 8081, 8094, 8107, 8119, 8131, 8143, 8155, 8167, 8179, 8192, 8205, 8218, 8230, 8244, 8255, 8267, 8279, 8291, 8303, 8315, 8328, 8340, 8353, 8366, 8378, 8392, 8404, 8417, 8431, 8443, 8455, 8467, 8479, 8492, 8504, 8516, 8529, 8543, 8555, 8567, 8580, 8593, 8606, 8619, 8632, 8644, 8658, 8670, 8683, 8695, 8708, 8721, 8733, 8746, 8759, 8771, 8783, 8795, 8808, 8821, 8833, 8845, 8858, 8871, 8885, 8898, 8910, 8923, 8936, 8949, 8960, 8973, 8986, 9000, 9012, 9025, 9038, 9051, 9064, 9076, 9089, 9102, 9114, 9126, 9139, 9151, 9164, 9177, 9191, 9204, 9217, 9230, 9243, 9255, 9268, 9281, 9294, 9307, 9320, 9333, 9345, 9358, 9371, 9384, 9398, 9412, 9424, 9437, 9450, 9462, 9475, 9488, 9501, 9514, 9528, 9542, 9554, 9567, 9581, 9593, 9606, 9619, 9632, 9645, 9658, 9671, 9682, 9695, 9708, 9721, 9735, 9749, 9762, 9776, 9789, 9802, 9815, 9828, 9842, 9855, 9867, 9880, 9893, 9906, 9920, 9933, 9947, 9960, 9974, 9987, 10000, 10014, 10027, 10040, 10054, 10067, 10081, 10095, 10107, 10120, 10134, 10148, 10161, 10175, 10188, 10201, 10214, 10228, 10241, 10254, 10267, 10280, 10294, 10309, 10322, 10335, 10348, 10362, 10374, 10387, 10401, 10415, 10428, 10441, 10455, 10469, 10482, 10497, 10510, 10523, 10537, 10551, 10565, 10579, 10593, 10606, 10621, 10634, 10647, 10661, 10675, 10689, 10704, 10719, 10732, 10746, 10760, 10774, 10788, 10802, 10815, 10829, 10843, 10856, 10871, 10884, 10898, 10913, 10927, 10940, 10955, 10970, 10984, 10999, 11013, 11027, 11042, 11056, 11071, 11086, 11100, 11114, 11128, 11142, 11158, 11171, 11186, 11200, 11213, 11228, 11241, 11255, 11270, 11284, 11299, 11314, 11328, 11342, 11356, 11370, 11385, 11399, 11413, 11429, 11445, 11460, 11474, 11489, 11503, 11518, 11533, 11549, 11563, 11577, 11592, 11607, 11621, 11637, 11651, 11665, 11680, 11694, 11708, 11725, 11740, 11754, 11768, 11784, 11798, 11813, 11828, 11843, 11858, 11874, 11888, 11904, 11920, 11933, 11948, 11964, 11979, 11993, 12009, 12024, 12041, 12058, 12071, 12087, 12102, 12117, 12132, 12148, 12165, 12179, 12195, 12210, 12226, 12241, 12256, 12273, 12288, 12304, 12320, 12335, 12350, 12365, 12382, 12398, 12414, 12430, 12446, 12462, 12478, 12495, 12511, 12525, 12541, 12556, 12575, 12591, 12605, 12622, 12638, 12653, 12671, 12686, 12705, 12721, 12739, 12756, 12772, 12788, 12806, 12822, 12839, 12855, 12873, 12890, 12908, 12923, 12941, 12960, 12975, 12992, 13009, 13024, 13040, 13059, 13076, 13092, 13109, 13128, 13145, 13161, 13179, 13194, 13216, 13233, 13249, 13266, 13287, 13303, 13322, 13337, 13357, 13375, 13392, 13410, 13424, 13446, 13465, 13480, 13499, 13517, 13533, 13559, 13575, 13595, 13612, 13632, 13650, 13670, 13687, 13706, 13726, 13744, 13765, 13783, 13803, 13822, 13841, 13860, 13879, 13897, 13917, 13936, 13960, 13979, 13996, 14019, 14040, 14057, 14077, 14102, 14122, 14141, 14163, 14184, 14202, 14225, 14244, 14265, 14287, 14312, 14336, 14356, 14375, 14393, 14420, 14438, 14465, 14483, 14500, 14536, 14555, 14575, 14604, 14619, 14648, 14668, 14691, 14725, 14748, 14770, 14788, 14818, 14840, 14862, 14888, 14921, 14939, 14969, 14996, 15022, 15051, 15075, 15098, 15130, 15149, 15167, 15218, 15237, 15276, 15297, 15333, 15356, 15379, 15418, 15447, 15481, 15508, 15530, 15574, 15599, 15643, 15680, 15697, 15743, 15759, 15775, 15813, 15845, 15877, 15911, 15931, 15968, 16014, 16049, 16077, 16088, 16138, 16149, 16185, 16200, 16241, 16280, 16296}; public ABITracerTest() { } @@ -70,5 +78,20 @@ public void testLocal() throws Exception { Assert.assertNotNull(file); ABITrace tracer = new ABITrace(file); Assert.assertNotNull(tracer); + + //Test length of tracer for file 3730.ab1 + Assert.assertEquals(16302, tracer.getTraceLength()); + //Test length of sequence for file 3730.ab1 + Assert.assertEquals(1165, tracer.getSequenceLength()); + + //Test sequence of tracer for file 3730.ab1 + Assert.assertTrue(sequence.equals(tracer.getSequence().getSequenceAsString())); + //Test array that represents the quality of tracer for file 3730.ab1 + Assert.assertArrayEquals(qual, tracer.getQcalls()); + //Test array that represents the baseline of tracer for file 3730.ab1 + Assert.assertArrayEquals(base, tracer.getBasecalls()); + //Test image of tracer for file 3730.ab1 + BufferedImage image = tracer.getImage(100,100); + Assert.assertNotNull(image); } } From e1ef8a36d88e06fed8b0fc05b1445790263cacea Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Mon, 7 May 2018 18:55:06 +0200 Subject: [PATCH 06/37] Code reviewer requests --- .../nbio/core/sequence/io/ABITrace.java | 179 ++++++++++-------- .../nbio/core/sequence/io/ABITracerTest.java | 15 +- 2 files changed, 111 insertions(+), 83 deletions(-) diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java index 648531cf54..1ef6a85b50 100644 --- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java @@ -36,41 +36,40 @@ import java.io.InputStream; import org.biojava.nbio.core.sequence.compound.ABITracerCompoundSet; -import org.biojava.nbio.core.sequence.compound.DNACompoundSet; import org.biojava.nbio.core.sequence.compound.NucleotideCompound; import org.biojava.nbio.core.sequence.template.AbstractSequence; import org.biojava.nbio.core.exceptions.CompoundNotFoundException; /** - * Title: ABITrace

+ * Title: ABITrace

* ABITrace is a class for managing ABI file information, * it is capable of opening an ABI file and storing * the most important fields, which can be recalled as simple java types. It can also return * an image corresponding to the trace. - * It has three constructors with input types File, URL, and byte[].

+ * It has three constructors with input types File, URL, and byte[].

* ABI files contain two sets of basecall and sequence data, one that was originally * created programatically and the other, which is an editable copy. This version of this object - * only references the original unedited data.
+ * only references the original unedited data.

*/ public class ABITrace { //the next three lines are the important persistent data private String sequence; - private int A[], G[], C[], T[], Basecalls[], Qcalls[]; - private int TraceLength, SeqLength; + private int A[], G[], C[], T[], baseCalls[], qCalls[]; + private int traceLength, seqLength; //This is the actual file data. - private byte[] TraceData; + private byte[] traceData; private int maximum = 0; //the next four declaration lines comprise the file index information - private int MacJunk = 0; //sometimes when macintosh files are + private int macJunk = 0; //sometimes when macintosh files are //FTPed in binary form, they have 128 bytes //of crap pre-pended to them. This constant //allows ABITrace to handle that in a way that //is invisible to the user. - private static int AbsIndexBase = 26; //The file location of the Index pointer + private static final int absIndexBase = 26; //The file location of the Index pointer private int IndexBase, PLOC, PCON; //the next declaration is for the actual file pointers @@ -83,38 +82,44 @@ public class ABITrace { * @throws IOException if there is a problem reading the file. * @throws IllegalArgumentException if the file is not a valid ABI file. */ - public ABITrace(File ABIFile) throws IOException { - byte[] bytes = null; - ByteArrayOutputStream baos = new ByteArrayOutputStream(); + public ABITrace(File ABIFile) throws IOException + { FileInputStream fis = new FileInputStream(ABIFile); BufferedInputStream bis = new BufferedInputStream(fis); - int b; - while ((b = bis.read()) >= 0) { - baos.write(b); - } - bis.close(); fis.close(); baos.close(); - bytes = baos.toByteArray(); - initData(bytes); + ABITraceInit(bis); + fis.close(); } /** * The URL constructor opens an ABI file from any URL. + * * @param ABIFile is a java.net.URL for an ABI trace file. * @throws IOException if there is a problem reading from the URL. * @throws IllegalArgumentException if the URL does not contain a valid ABI file. */ public ABITrace( URL ABIFile ) throws IOException { - byte[] bytes = null; - ByteArrayOutputStream baos = new ByteArrayOutputStream(); InputStream is = ABIFile.openStream(); BufferedInputStream bis = new BufferedInputStream(is); + ABITraceInit(bis); + is.close(); + } + + /** + * Helper method for constructors + * + * @param bis - BufferedInputStream + * @throws IOException if there is a problem reading from the BufferedInputStream + */ + private void ABITraceInit(BufferedInputStream bis) throws IOException{ + byte[] bytes = null; + ByteArrayOutputStream baos = new ByteArrayOutputStream(); int b; while ((b = bis.read()) >= 0) { baos.write(b); } - bis.close(); is.close(); baos.close(); + bis.close(); baos.close(); bytes = baos.toByteArray(); initData(bytes); } @@ -122,6 +127,7 @@ public ABITrace( URL ABIFile ) throws IOException /** * The byte[] constructor parses an ABI file represented as a byte array. * + * @param ABIFileData - byte array * @throws IllegalArgumentException if the data does not represent a valid ABI file. */ public ABITrace(byte[] ABIFileData) { @@ -130,45 +136,50 @@ public ABITrace(byte[] ABIFileData) { /** * Returns the length of the sequence (number of bases) in this trace. + * + * @return int seqLength */ public int getSequenceLength() { - return SeqLength; + return seqLength; } /** * Returns the length of the trace (number of x-coordinate points in the graph). + * + * @return int traceLength */ public int getTraceLength() { - return TraceLength; + return traceLength; } /** * Returns an int[] array that represents the basecalls - each int in the * array corresponds to an x-coordinate point in the graph that is a peak (a base location). + * + * @return int[] Basecalls */ public int[] getBasecalls() { - return Basecalls; + return baseCalls; } /** * Returns an int[] array that represents the quality - each int in the * array corresponds to an quality value 90-255) in the graph at a base location). + * + * @return int[] qCalls */ public int[] getQcalls() { - return Qcalls; + return qCalls; } /** * Returns the original programmatically determined (unedited) sequence as a AbstractSequence. + * + * @return AbstractSequence sequence */ public AbstractSequence getSequence() throws CompoundNotFoundException { - try { - DNASequenceCreator creator = new DNASequenceCreator(ABITracerCompoundSet.getABITracerCompoundSet()); - return creator.getSequence(sequence, 0); - } catch (Exception e) { - // this should be impossible! - throw new CompoundNotFoundException(e.toString()); - } + DNASequenceCreator creator = new DNASequenceCreator(ABITracerCompoundSet.getABITracerCompoundSet()); + return creator.getSequence(sequence, 0); } /** @@ -177,7 +188,7 @@ public AbstractSequence getSequence() throws CompoundNotFoun * position in the array, so that if element 4 in the array is 972, then * x is 4 and y is 972 for that point. * - * @param base the DNA String to retrieve the trace values for + * @param base - the DNA String to retrieve the trace values for * @return an array of ints giving the entire trace for that base * @throws CompoundNotFoundException if the base is not valid */ @@ -201,11 +212,12 @@ public int[] getTrace (String base) throws CompoundNotFoundException { * of points in the trace (getTraceLength()). The entire trace is represented * in the returned image. * - * @param imageHeight is the desired height of the image in pixels. - * @param widthScale indiates how many horizontal pixels to use to represent a single x-coordinate (try 2). + * @param imageHeight - desired height of the image in pixels. + * @param widthScale - how many horizontal pixels to use to represent a single x-coordinate (try 2). + * @return BufferedImage image */ public BufferedImage getImage(int imageHeight, int widthScale) { - BufferedImage out = new BufferedImage(TraceLength * widthScale, imageHeight, BufferedImage.TYPE_BYTE_INDEXED); + BufferedImage out = new BufferedImage(traceLength * widthScale, imageHeight, BufferedImage.TYPE_BYTE_INDEXED); Graphics2D g = out.createGraphics(); Color acolor = Color.green.darker(); Color ccolor = Color.blue; @@ -213,14 +225,14 @@ public BufferedImage getImage(int imageHeight, int widthScale) { Color tcolor = Color.red; Color ncolor = Color.pink; double scale = calculateScale(imageHeight); - int[] bc = Basecalls; + int[] bc = baseCalls; char[] seq = sequence.toCharArray(); g.setBackground(Color.white); - g.clearRect(0, 0, TraceLength * widthScale, imageHeight); + g.clearRect(0, 0, traceLength * widthScale, imageHeight); int here = 0; int basenum = 0; for (int q = 1; q <= 5; q++) { - for (int x = 0; x <= TraceLength - 2; x++) { + for (int x = 0; x <= traceLength - 2; x++) { if (q == 1) { g.setColor(acolor); g.drawLine(2 * x, transmute(A[x], imageHeight, scale), @@ -289,6 +301,11 @@ public BufferedImage getImage(int imageHeight, int widthScale) { /** * Utility method to translate y coordinates from graph space (where up is greater) * to image space (where down is greater). + * + * @param ya + * @param height + * @param scale + * @return - translated y coordinates from graph space (where up is greater) to image space */ private int transmute(int ya, int height, double scale) { return (height - 45 - (int) (ya * scale)); @@ -301,7 +318,8 @@ private int transmute(int ya, int height, double scale) { * Returns the scaling factor necessary to allow all of the traces to fit vertically * into the specified space. * - * @param - the required height in pixels. + * @param height - required height in pixels + * @return - scaling factor */ private double calculateScale(int height) { double newScale = 0.0; @@ -314,6 +332,8 @@ private double calculateScale(int height) { /** * Get the maximum height of any of the traces. The data is persisted for performance * in the event of multiple calls, but it initialized lazily. + * + * @return - maximum height of any of the traces */ private int getMaximum() { if (maximum > 0) return maximum; @@ -330,10 +350,11 @@ private int getMaximum() { /** * Initialize all of the data fields for this object. * + * @param fileData - data for object * @throws IllegalArgumentException which will propagate to all of the constructors. */ private void initData(byte[] fileData) { - TraceData = fileData; + traceData = fileData; if (isABI()) { setIndex(); setBasecalls(); @@ -358,7 +379,7 @@ private void setTraces() { datas[3] = DATA12; for (int i = 0; i <= 3; i++) { - order[i] = (char) TraceData[FWO + i]; + order[i] = (char) traceData[FWO + i]; } for (int i = 0; i <= 3; i++) { @@ -384,16 +405,16 @@ private void setTraces() { } } - A = new int[TraceLength]; - C = new int[TraceLength]; - G = new int[TraceLength]; - T = new int[TraceLength]; + A = new int[traceLength]; + C = new int[traceLength]; + G = new int[traceLength]; + T = new int[traceLength]; for (int i = 0; i <= 3; i++) { - byte[] qq = new byte[TraceLength * 2]; + byte[] qq = new byte[traceLength * 2]; getSubArray(qq, pointers[i]); DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); - for (int x = 0; x <= TraceLength - 1; x++) { + for (int x = 0; x <= traceLength - 1; x++) { try { if (i == 0) A[x] = (int) dis.readShort(); if (i == 1) C[x] = (int) dis.readShort(); @@ -412,9 +433,9 @@ private void setTraces() { * Fetch the sequence from the trace data. */ private void setSeq() { - char tempseq[] = new char[SeqLength]; - for (int x = 0; x <= SeqLength - 1; ++x) { - tempseq[x] = (char) TraceData[PBAS2 + x]; + char tempseq[] = new char[seqLength]; + for (int x = 0; x <= seqLength - 1; ++x) { + tempseq[x] = (char) traceData[PBAS2 + x]; } sequence = new String(tempseq); } @@ -423,13 +444,13 @@ private void setSeq() { * Fetch the quality calls from the trace data. */ private void setQcalls() { - Qcalls = new int[SeqLength]; - byte[] qq = new byte[SeqLength]; + qCalls = new int[seqLength]; + byte[] qq = new byte[seqLength]; getSubArray(qq, PCON); DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); - for (int i = 0; i <= SeqLength - 1; ++i) { + for (int i = 0; i <= seqLength - 1; ++i) { try { - Qcalls[i] = (int) dis.readByte(); + qCalls[i] = (int) dis.readByte(); } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong. { throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); @@ -441,13 +462,13 @@ private void setQcalls() { * Fetch the basecalls from the trace data. */ private void setBasecalls() { - Basecalls = new int[SeqLength]; - byte[] qq = new byte[SeqLength * 2]; + baseCalls = new int[seqLength]; + byte[] qq = new byte[seqLength * 2]; getSubArray(qq, PLOC); DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq)); - for (int i = 0; i <= SeqLength - 1; ++i) { + for (int i = 0; i <= seqLength - 1; ++i) { try { - Basecalls[i] = (int) dis.readShort(); + baseCalls[i] = (int) dis.readShort(); } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong. { throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams."); @@ -468,8 +489,8 @@ private void setIndex() { PLOCCounter = 0; PCONCounter = 0; - IndexBase = getIntAt(AbsIndexBase + MacJunk); - NumRecords = getIntAt(AbsIndexBase - 8 + MacJunk); + IndexBase = getIntAt(absIndexBase + macJunk); + NumRecords = getIntAt(absIndexBase - 8 + macJunk); for (int record = 0; record <= NumRecords - 1; record++) { getSubArray(RecNameArray, (IndexBase + (record * 28))); @@ -504,19 +525,22 @@ private void setIndex() { } } //next record - TraceLength = getIntAt(DATA12 - 8); - SeqLength = getIntAt(PBAS2 - 4); - PLOC = getIntAt(PLOC) + MacJunk; - DATA9 = getIntAt(DATA9) + MacJunk; - DATA10 = getIntAt(DATA10) + MacJunk; - DATA11 = getIntAt(DATA11) + MacJunk; - DATA12 = getIntAt(DATA12) + MacJunk; - PBAS2 = getIntAt(PBAS2) + MacJunk; - PCON = getIntAt(PCON) + MacJunk; + traceLength = getIntAt(DATA12 - 8); + seqLength = getIntAt(PBAS2 - 4); + PLOC = getIntAt(PLOC) + macJunk; + DATA9 = getIntAt(DATA9) + macJunk; + DATA10 = getIntAt(DATA10) + macJunk; + DATA11 = getIntAt(DATA11) + macJunk; + DATA12 = getIntAt(DATA12) + macJunk; + PBAS2 = getIntAt(PBAS2) + macJunk; + PCON = getIntAt(PCON) + macJunk; } /** * Utility method to return an int beginning at pointer in the TraceData array. + * + * @param pointer - beginning of trace array + * @return - int beginning at pointer in trace array */ private int getIntAt(int pointer) { int out = 0; @@ -534,10 +558,13 @@ private int getIntAt(int pointer) { /** * A utility method which fills array b with data from the trace starting at traceDataOffset. + * + * @param b - trace byte array + * @param traceDataOffset - starting point */ private void getSubArray(byte[] b, int traceDataOffset) { for (int x = 0; x <= b.length - 1; x++) { - b[x] = TraceData[traceDataOffset + x]; + b[x] = traceData[traceDataOffset + x]; } } @@ -545,21 +572,23 @@ private void getSubArray(byte[] b, int traceDataOffset) { * Test to see if the file is ABI format by checking to see that the first three bytes * are "ABI". Also handle the special case where 128 bytes were prepended to the file * due to binary FTP from an older macintosh system. + * + * @return - if format of ABI file is correct */ private boolean isABI() { char ABI[] = new char[4]; for (int i = 0; i <= 2; i++) { - ABI[i] = (char) TraceData[i]; + ABI[i] = (char) traceData[i]; } if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) { return true; } else { for (int i = 128; i <= 130; i++) { - ABI[i-128] = (char) TraceData[i]; + ABI[i-128] = (char) traceData[i]; } if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) { - MacJunk = 128; + macJunk = 128; return true; } else return false; diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java index 6604199f81..719b813d00 100644 --- a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java +++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java @@ -28,11 +28,10 @@ /** * Test file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/3730.ab1 - * The test data for comparing the results from ABITracer for file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/test_data + * The test data for comparing the results from ABITrace.java for file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/test_data */ public class ABITracerTest { - private String filePath = System.getProperty("user.dir") + "/src/test/resources/3730.ab1"; private String sequence = "GGGCGAGCKYYAYATTTTGGCAAGAATTGAGCTCTATGGCCACAACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGGGCGGCAGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAARACCCGCGCCGAGGTGAARTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAAGGGGCAYCGCACCTTTC"; private int[] qual = {20, 3, 4, 4, 4, 6, 4, 4, 0, 0, 0, 6, 0, 10, 20, 26, 22, 17, 21, 31, 29, 32, 28, 18, 23, 17, 19, 35, 36, 50, 39, 50, 50, 50, 50, 50, 25, 35, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 39, 33, 20, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 50, 35, 31, 23, 28, 31, 21, 43, 39, 35, 24, 30, 26, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 39, 31, 24, 39, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 43, 43, 50, 50, 50, 50, 50, 31, 31, 31, 31, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 35, 50, 50, 50, 50, 31, 36, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 37, 38, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 35, 35, 36, 36, 21, 39, 35, 35, 35, 39, 35, 37, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 35, 28, 28, 35, 35, 35, 36, 36, 22, 39, 35, 35, 35, 35, 35, 35, 37, 38, 28, 35, 21, 36, 36, 37, 35, 35, 20, 39, 39, 35, 35, 35, 35, 37, 38, 28, 35, 37, 34, 35, 24, 24, 27, 25, 20, 24, 37, 35, 27, 21, 20, 21, 27, 17, 20, 24, 32, 26, 20, 12, 20, 10, 20, 24, 25, 23, 20, 32, 24, 24, 23, 20, 24, 23, 18, 34, 34, 34, 22, 26, 24, 24, 18, 22, 22, 23, 25, 20, 12, 20, 24, 23, 24, 23, 22, 20, 20, 0, 20, 24, 23, 20, 8, 10, 4, 20, 20, 3, 7, 19, 20, 4, 4, 7, 7, 0, 7, 11, 18, 8, 3, 23, 23, 20, 11, 4, 20, 18, 12, 20, 20, 20, 4, 20, 4, 2, 3, 21, 21, 21, 21, 10, 15, 14, 15, 19, 2, 4, 3, 6, 11, 3, 4, 6, 21, 16, 20, 11, 1, 4, 12, 0, 15, 8, 1, 3, 3, 12, 1, 11, 20, 4}; private int[] base = {2, 13, 38, 51, 67, 78, 92, 118, 138, 162, 181, 191, 210, 222, 239, 253, 266, 280, 288, 304, 317, 333, 347, 359, 375, 386, 394, 406, 418, 433, 444, 457, 472, 482, 496, 506, 519, 529, 544, 557, 569, 579, 590, 601, 614, 626, 638, 649, 663, 673, 686, 706, 715, 731, 740, 753, 765, 777, 787, 799, 813, 826, 838, 854, 863, 876, 892, 901, 913, 929, 937, 948, 960, 970, 981, 993, 1004, 1017, 1034, 1045, 1056, 1068, 1080, 1091, 1103, 1115, 1126, 1138, 1148, 1160, 1177, 1187, 1199, 1211, 1222, 1232, 1243, 1254, 1268, 1279, 1294, 1307, 1319, 1330, 1341, 1352, 1362, 1374, 1388, 1398, 1411, 1422, 1433, 1444, 1456, 1466, 1479, 1497, 1506, 1519, 1531, 1543, 1556, 1567, 1578, 1589, 1604, 1614, 1630, 1641, 1651, 1662, 1675, 1688, 1700, 1711, 1721, 1732, 1748, 1758, 1772, 1784, 1795, 1806, 1820, 1830, 1844, 1855, 1866, 1877, 1892, 1902, 1914, 1926, 1939, 1950, 1965, 1974, 1986, 1999, 2011, 2023, 2037, 2047, 2059, 2072, 2084, 2096, 2107, 2120, 2132, 2144, 2156, 2169, 2180, 2191, 2202, 2217, 2227, 2239, 2251, 2264, 2275, 2286, 2297, 2309, 2321, 2332, 2347, 2358, 2369, 2381, 2394, 2406, 2417, 2429, 2439, 2452, 2465, 2476, 2490, 2501, 2512, 2524, 2536, 2546, 2560, 2570, 2581, 2593, 2605, 2616, 2628, 2640, 2653, 2664, 2676, 2688, 2700, 2712, 2723, 2735, 2748, 2759, 2772, 2784, 2795, 2808, 2820, 2831, 2842, 2854, 2866, 2878, 2888, 2901, 2913, 2927, 2936, 2947, 2958, 2970, 2982, 2994, 3005, 3019, 3030, 3041, 3053, 3064, 3077, 3088, 3099, 3110, 3123, 3135, 3146, 3157, 3168, 3179, 3192, 3203, 3214, 3226, 3238, 3251, 3263, 3275, 3286, 3297, 3308, 3320, 3331, 3344, 3356, 3368, 3380, 3391, 3402, 3415, 3426, 3440, 3451, 3462, 3474, 3485, 3496, 3508, 3520, 3532, 3543, 3556, 3569, 3580, 3593, 3604, 3615, 3626, 3638, 3650, 3661, 3673, 3684, 3698, 3709, 3721, 3732, 3744, 3756, 3767, 3779, 3792, 3803, 3814, 3827, 3838, 3850, 3862, 3873, 3885, 3897, 3909, 3920, 3932, 3943, 3955, 3966, 3980, 3990, 4002, 4014, 4026, 4038, 4050, 4061, 4072, 4083, 4095, 4107, 4119, 4131, 4143, 4156, 4167, 4179, 4191, 4203, 4215, 4227, 4238, 4252, 4262, 4274, 4287, 4298, 4310, 4321, 4333, 4345, 4356, 4370, 4381, 4393, 4406, 4417, 4428, 4440, 4453, 4464, 4477, 4489, 4500, 4513, 4524, 4536, 4548, 4560, 4573, 4583, 4595, 4607, 4620, 4631, 4645, 4655, 4667, 4679, 4690, 4702, 4714, 4728, 4739, 4750, 4762, 4774, 4786, 4798, 4810, 4821, 4833, 4845, 4857, 4869, 4880, 4892, 4905, 4916, 4927, 4940, 4952, 4963, 4977, 4988, 5000, 5012, 5023, 5034, 5045, 5057, 5069, 5081, 5093, 5104, 5115, 5127, 5139, 5151, 5163, 5176, 5188, 5199, 5211, 5223, 5235, 5247, 5259, 5272, 5283, 5296, 5308, 5320, 5331, 5343, 5354, 5366, 5378, 5390, 5402, 5414, 5426, 5438, 5450, 5462, 5474, 5486, 5497, 5510, 5521, 5532, 5544, 5557, 5569, 5581, 5592, 5604, 5617, 5629, 5641, 5652, 5663, 5676, 5687, 5699, 5712, 5724, 5735, 5748, 5760, 5771, 5784, 5794, 5806, 5817, 5829, 5841, 5853, 5866, 5879, 5891, 5903, 5916, 5928, 5941, 5952, 5964, 5976, 5988, 6000, 6012, 6024, 6036, 6048, 6060, 6072, 6085, 6096, 6109, 6121, 6133, 6146, 6157, 6168, 6180, 6192, 6203, 6215, 6227, 6239, 6251, 6265, 6276, 6289, 6302, 6313, 6325, 6337, 6349, 6361, 6374, 6386, 6398, 6410, 6422, 6436, 6448, 6459, 6471, 6483, 6495, 6507, 6520, 6532, 6545, 6555, 6567, 6579, 6591, 6603, 6615, 6627, 6640, 6652, 6664, 6676, 6688, 6700, 6713, 6726, 6738, 6749, 6761, 6774, 6786, 6799, 6811, 6823, 6835, 6848, 6859, 6871, 6883, 6895, 6907, 6920, 6933, 6945, 6956, 6968, 6980, 6992, 7005, 7016, 7030, 7042, 7053, 7066, 7079, 7091, 7104, 7115, 7128, 7140, 7152, 7163, 7175, 7187, 7200, 7212, 7224, 7235, 7248, 7260, 7272, 7285, 7297, 7309, 7321, 7333, 7345, 7358, 7370, 7382, 7394, 7406, 7419, 7431, 7443, 7455, 7468, 7480, 7492, 7505, 7517, 7530, 7542, 7554, 7566, 7578, 7591, 7603, 7615, 7628, 7640, 7653, 7666, 7677, 7690, 7702, 7714, 7727, 7738, 7750, 7762, 7775, 7786, 7799, 7812, 7823, 7836, 7848, 7859, 7871, 7884, 7896, 7909, 7921, 7933, 7946, 7958, 7971, 7984, 7996, 8007, 8019, 8032, 8044, 8056, 8069, 8081, 8094, 8107, 8119, 8131, 8143, 8155, 8167, 8179, 8192, 8205, 8218, 8230, 8244, 8255, 8267, 8279, 8291, 8303, 8315, 8328, 8340, 8353, 8366, 8378, 8392, 8404, 8417, 8431, 8443, 8455, 8467, 8479, 8492, 8504, 8516, 8529, 8543, 8555, 8567, 8580, 8593, 8606, 8619, 8632, 8644, 8658, 8670, 8683, 8695, 8708, 8721, 8733, 8746, 8759, 8771, 8783, 8795, 8808, 8821, 8833, 8845, 8858, 8871, 8885, 8898, 8910, 8923, 8936, 8949, 8960, 8973, 8986, 9000, 9012, 9025, 9038, 9051, 9064, 9076, 9089, 9102, 9114, 9126, 9139, 9151, 9164, 9177, 9191, 9204, 9217, 9230, 9243, 9255, 9268, 9281, 9294, 9307, 9320, 9333, 9345, 9358, 9371, 9384, 9398, 9412, 9424, 9437, 9450, 9462, 9475, 9488, 9501, 9514, 9528, 9542, 9554, 9567, 9581, 9593, 9606, 9619, 9632, 9645, 9658, 9671, 9682, 9695, 9708, 9721, 9735, 9749, 9762, 9776, 9789, 9802, 9815, 9828, 9842, 9855, 9867, 9880, 9893, 9906, 9920, 9933, 9947, 9960, 9974, 9987, 10000, 10014, 10027, 10040, 10054, 10067, 10081, 10095, 10107, 10120, 10134, 10148, 10161, 10175, 10188, 10201, 10214, 10228, 10241, 10254, 10267, 10280, 10294, 10309, 10322, 10335, 10348, 10362, 10374, 10387, 10401, 10415, 10428, 10441, 10455, 10469, 10482, 10497, 10510, 10523, 10537, 10551, 10565, 10579, 10593, 10606, 10621, 10634, 10647, 10661, 10675, 10689, 10704, 10719, 10732, 10746, 10760, 10774, 10788, 10802, 10815, 10829, 10843, 10856, 10871, 10884, 10898, 10913, 10927, 10940, 10955, 10970, 10984, 10999, 11013, 11027, 11042, 11056, 11071, 11086, 11100, 11114, 11128, 11142, 11158, 11171, 11186, 11200, 11213, 11228, 11241, 11255, 11270, 11284, 11299, 11314, 11328, 11342, 11356, 11370, 11385, 11399, 11413, 11429, 11445, 11460, 11474, 11489, 11503, 11518, 11533, 11549, 11563, 11577, 11592, 11607, 11621, 11637, 11651, 11665, 11680, 11694, 11708, 11725, 11740, 11754, 11768, 11784, 11798, 11813, 11828, 11843, 11858, 11874, 11888, 11904, 11920, 11933, 11948, 11964, 11979, 11993, 12009, 12024, 12041, 12058, 12071, 12087, 12102, 12117, 12132, 12148, 12165, 12179, 12195, 12210, 12226, 12241, 12256, 12273, 12288, 12304, 12320, 12335, 12350, 12365, 12382, 12398, 12414, 12430, 12446, 12462, 12478, 12495, 12511, 12525, 12541, 12556, 12575, 12591, 12605, 12622, 12638, 12653, 12671, 12686, 12705, 12721, 12739, 12756, 12772, 12788, 12806, 12822, 12839, 12855, 12873, 12890, 12908, 12923, 12941, 12960, 12975, 12992, 13009, 13024, 13040, 13059, 13076, 13092, 13109, 13128, 13145, 13161, 13179, 13194, 13216, 13233, 13249, 13266, 13287, 13303, 13322, 13337, 13357, 13375, 13392, 13410, 13424, 13446, 13465, 13480, 13499, 13517, 13533, 13559, 13575, 13595, 13612, 13632, 13650, 13670, 13687, 13706, 13726, 13744, 13765, 13783, 13803, 13822, 13841, 13860, 13879, 13897, 13917, 13936, 13960, 13979, 13996, 14019, 14040, 14057, 14077, 14102, 14122, 14141, 14163, 14184, 14202, 14225, 14244, 14265, 14287, 14312, 14336, 14356, 14375, 14393, 14420, 14438, 14465, 14483, 14500, 14536, 14555, 14575, 14604, 14619, 14648, 14668, 14691, 14725, 14748, 14770, 14788, 14818, 14840, 14862, 14888, 14921, 14939, 14969, 14996, 15022, 15051, 15075, 15098, 15130, 15149, 15167, 15218, 15237, 15276, 15297, 15333, 15356, 15379, 15418, 15447, 15481, 15508, 15530, 15574, 15599, 15643, 15680, 15697, 15743, 15759, 15775, 15813, 15845, 15877, 15911, 15931, 15968, 16014, 16049, 16077, 16088, 16138, 16149, 16185, 16200, 16241, 16280, 16296}; @@ -61,11 +60,9 @@ public void tearDown() { */ @Test public void testURL() throws Exception { - File file = new File(filePath); - Assert.assertNotNull(file); - URL url = file.toURI().toURL(); - Assert.assertNotNull(url); - ABITrace tracer = new ABITrace(url); + URL resource = this.getClass().getResource("/3730.ab1"); + Assert.assertNotNull(resource); + ABITrace tracer = new ABITrace(resource); Assert.assertNotNull(tracer); } @@ -74,7 +71,9 @@ public void testURL() throws Exception { */ @Test public void testLocal() throws Exception { - File file = new File(filePath); + URL resource = this.getClass().getResource("/3730.ab1"); + Assert.assertNotNull(resource); + File file = new File(resource.toURI()); Assert.assertNotNull(file); ABITrace tracer = new ABITrace(file); Assert.assertNotNull(tracer); From c6fa93bbd538b82f376bb1cf934fbbd971821e85 Mon Sep 17 00:00:00 2001 From: MaxGreil Date: Mon, 7 May 2018 20:34:26 +0200 Subject: [PATCH 07/37] Fixed minor issues --- .../nbio/core/sequence/io/ABITrace.java | 27 +++++++++---------- 1 file changed, 12 insertions(+), 15 deletions(-) diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java index 1ef6a85b50..b11b8e3c42 100644 --- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/io/ABITrace.java @@ -61,8 +61,6 @@ public class ABITrace { //This is the actual file data. private byte[] traceData; - private int maximum = 0; - //the next four declaration lines comprise the file index information private int macJunk = 0; //sometimes when macintosh files are //FTPed in binary form, they have 128 bytes @@ -70,7 +68,7 @@ public class ABITrace { //allows ABITrace to handle that in a way that //is invisible to the user. private static final int absIndexBase = 26; //The file location of the Index pointer - private int IndexBase, PLOC, PCON; + private int PLOC, PCON; //the next declaration is for the actual file pointers private int DATA9, DATA10, DATA11, DATA12, PBAS2, FWO; @@ -336,7 +334,6 @@ private double calculateScale(int height) { * @return - maximum height of any of the traces */ private int getMaximum() { - if (maximum > 0) return maximum; int max = 0; for (int x = 0; x <= T.length - 1; x++) { if (T[x] > max) max = T[x]; @@ -480,7 +477,7 @@ private void setBasecalls() { * Sets up all of the initial pointers to the important records in TraceData. */ private void setIndex() { - int DataCounter, PBASCounter, PLOCCounter, PCONCounter, NumRecords; + int DataCounter, PBASCounter, PLOCCounter, PCONCounter, NumRecords, indexBase; byte[] RecNameArray = new byte[4]; String RecName; @@ -489,39 +486,39 @@ private void setIndex() { PLOCCounter = 0; PCONCounter = 0; - IndexBase = getIntAt(absIndexBase + macJunk); + indexBase = getIntAt(absIndexBase + macJunk); NumRecords = getIntAt(absIndexBase - 8 + macJunk); for (int record = 0; record <= NumRecords - 1; record++) { - getSubArray(RecNameArray, (IndexBase + (record * 28))); + getSubArray(RecNameArray, (indexBase + (record * 28))); RecName = new String(RecNameArray); if (RecName.equals("FWO_")) - FWO = IndexBase + (record * 28) + 20; + FWO = indexBase + (record * 28) + 20; if (RecName.equals("DATA")) { ++DataCounter; if (DataCounter == 9) - DATA9 = IndexBase + (record * 28) + 20; + DATA9 = indexBase + (record * 28) + 20; if (DataCounter == 10) - DATA10 = IndexBase + (record * 28) + 20; + DATA10 = indexBase + (record * 28) + 20; if (DataCounter == 11) - DATA11 = IndexBase + (record * 28) + 20; + DATA11 = indexBase + (record * 28) + 20; if (DataCounter == 12) - DATA12 = IndexBase + (record * 28) + 20; + DATA12 = indexBase + (record * 28) + 20; } if (RecName.equals("PBAS")) { ++PBASCounter; if (PBASCounter == 2) - PBAS2 = IndexBase + (record * 28) + 20; + PBAS2 = indexBase + (record * 28) + 20; } if (RecName.equals("PLOC")) { ++PLOCCounter; if (PLOCCounter == 2) - PLOC = IndexBase + (record * 28) + 20; + PLOC = indexBase + (record * 28) + 20; } if (RecName.equals("PCON")) { ++PCONCounter; if (PCONCounter == 2) - PCON = IndexBase + (record * 28) + 20; + PCON = indexBase + (record * 28) + 20; } } //next record From 4140859a3c6f82c5ddf2fe581337c8b3e66271bf Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Fri, 11 May 2018 10:30:30 -0700 Subject: [PATCH 08/37] [maven-release-plugin] prepare for next development iteration --- biojava-aa-prop/pom.xml | 6 +++--- biojava-alignment/pom.xml | 4 ++-- biojava-core/pom.xml | 2 +- biojava-genome/pom.xml | 6 +++--- biojava-integrationtest/pom.xml | 4 ++-- biojava-modfinder/pom.xml | 4 ++-- biojava-ontology/pom.xml | 2 +- biojava-protein-disorder/pom.xml | 4 ++-- biojava-structure-gui/pom.xml | 6 +++--- biojava-structure/pom.xml | 6 +++--- biojava-survival/pom.xml | 2 +- biojava-ws/pom.xml | 4 ++-- pom.xml | 4 ++-- 13 files changed, 27 insertions(+), 27 deletions(-) diff --git a/biojava-aa-prop/pom.xml b/biojava-aa-prop/pom.xml index fa35407577..3e1148e9a9 100644 --- a/biojava-aa-prop/pom.xml +++ b/biojava-aa-prop/pom.xml @@ -2,7 +2,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT 4.0.0 biojava-aa-prop @@ -70,12 +70,12 @@ org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT org.biojava biojava-structure - 5.0.1 + 5.0.2-SNAPSHOT diff --git a/biojava-alignment/pom.xml b/biojava-alignment/pom.xml index cbf5ae5a47..193abba94a 100644 --- a/biojava-alignment/pom.xml +++ b/biojava-alignment/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-alignment biojava-alignment @@ -47,7 +47,7 @@ org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT compile diff --git a/biojava-core/pom.xml b/biojava-core/pom.xml index 00fe539ebe..336c35486d 100644 --- a/biojava-core/pom.xml +++ b/biojava-core/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT 4.0.0 biojava-core diff --git a/biojava-genome/pom.xml b/biojava-genome/pom.xml index 072ce66d85..aa1f0f578e 100644 --- a/biojava-genome/pom.xml +++ b/biojava-genome/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT 4.0.0 biojava-genome @@ -85,13 +85,13 @@ org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT compile org.biojava biojava-alignment - 5.0.1 + 5.0.2-SNAPSHOT compile diff --git a/biojava-integrationtest/pom.xml b/biojava-integrationtest/pom.xml index b8e58dbd62..05db6cf131 100644 --- a/biojava-integrationtest/pom.xml +++ b/biojava-integrationtest/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-integrationtest jar @@ -28,7 +28,7 @@ org.biojava biojava-structure - 5.0.1 + 5.0.2-SNAPSHOT diff --git a/biojava-modfinder/pom.xml b/biojava-modfinder/pom.xml index 404ffdd16d..7c4251cda5 100644 --- a/biojava-modfinder/pom.xml +++ b/biojava-modfinder/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-modfinder biojava-modfinder @@ -31,7 +31,7 @@ org.biojava biojava-structure - 5.0.1 + 5.0.2-SNAPSHOT jar compile diff --git a/biojava-ontology/pom.xml b/biojava-ontology/pom.xml index c95707f5db..fcf5b5e34f 100644 --- a/biojava-ontology/pom.xml +++ b/biojava-ontology/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-ontology diff --git a/biojava-protein-disorder/pom.xml b/biojava-protein-disorder/pom.xml index 8a0aaf6af5..3307d8130c 100644 --- a/biojava-protein-disorder/pom.xml +++ b/biojava-protein-disorder/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-protein-disorder jar @@ -63,7 +63,7 @@ org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT diff --git a/biojava-structure-gui/pom.xml b/biojava-structure-gui/pom.xml index 997c104af6..490b31b1d2 100644 --- a/biojava-structure-gui/pom.xml +++ b/biojava-structure-gui/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT 4.0.0 biojava-structure-gui @@ -27,13 +27,13 @@ org.biojava biojava-structure - 5.0.1 + 5.0.2-SNAPSHOT compile org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT compile diff --git a/biojava-structure/pom.xml b/biojava-structure/pom.xml index 82c8eabb01..da120da772 100644 --- a/biojava-structure/pom.xml +++ b/biojava-structure/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-structure biojava-structure @@ -40,13 +40,13 @@ org.biojava biojava-alignment - 5.0.1 + 5.0.2-SNAPSHOT compile org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT compile diff --git a/biojava-survival/pom.xml b/biojava-survival/pom.xml index aa1bd5c801..7ea9ba5a20 100644 --- a/biojava-survival/pom.xml +++ b/biojava-survival/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-survival diff --git a/biojava-ws/pom.xml b/biojava-ws/pom.xml index e4d66dda78..9dd4cd10e6 100644 --- a/biojava-ws/pom.xml +++ b/biojava-ws/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.1 + 5.0.2-SNAPSHOT biojava-ws biojava-ws @@ -19,7 +19,7 @@ org.biojava biojava-core - 5.0.1 + 5.0.2-SNAPSHOT compile diff --git a/pom.xml b/pom.xml index dd1a210b4e..ec62c619b1 100644 --- a/pom.xml +++ b/pom.xml @@ -12,7 +12,7 @@ org.biojava biojava pom - 5.0.1 + 5.0.2-SNAPSHOT biojava BioJava is an open-source project dedicated to providing a Java framework for processing biological data. It provides analytical and statistical routines, parsers for common file formats and allows the @@ -48,7 +48,7 @@ scm:git:git@github.com:biojava/biojava.git https://github.com/biojava/biojava - biojava-5.0.1 + HEAD diff --git a/biojava-alignment/pom.xml b/biojava-alignment/pom.xml index 193abba94a..c620f57c9d 100644 --- a/biojava-alignment/pom.xml +++ b/biojava-alignment/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-alignment biojava-alignment @@ -47,7 +47,7 @@ org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile diff --git a/biojava-core/pom.xml b/biojava-core/pom.xml index 336c35486d..e53410e282 100644 --- a/biojava-core/pom.xml +++ b/biojava-core/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT 4.0.0 biojava-core diff --git a/biojava-genome/pom.xml b/biojava-genome/pom.xml index aa1f0f578e..c3eebdd65f 100644 --- a/biojava-genome/pom.xml +++ b/biojava-genome/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT 4.0.0 biojava-genome @@ -85,13 +85,13 @@ org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile org.biojava biojava-alignment - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile diff --git a/biojava-integrationtest/pom.xml b/biojava-integrationtest/pom.xml index 05db6cf131..9e13910c63 100644 --- a/biojava-integrationtest/pom.xml +++ b/biojava-integrationtest/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-integrationtest jar @@ -28,7 +28,7 @@ org.biojava biojava-structure - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT diff --git a/biojava-modfinder/pom.xml b/biojava-modfinder/pom.xml index 7c4251cda5..2424dfb8ce 100644 --- a/biojava-modfinder/pom.xml +++ b/biojava-modfinder/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-modfinder biojava-modfinder @@ -31,7 +31,7 @@ org.biojava biojava-structure - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT jar compile diff --git a/biojava-ontology/pom.xml b/biojava-ontology/pom.xml index fcf5b5e34f..ada60c174c 100644 --- a/biojava-ontology/pom.xml +++ b/biojava-ontology/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-ontology diff --git a/biojava-protein-disorder/pom.xml b/biojava-protein-disorder/pom.xml index 3307d8130c..ae653bdf00 100644 --- a/biojava-protein-disorder/pom.xml +++ b/biojava-protein-disorder/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-protein-disorder jar @@ -63,7 +63,7 @@ org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT diff --git a/biojava-structure-gui/pom.xml b/biojava-structure-gui/pom.xml index 490b31b1d2..97147f839b 100644 --- a/biojava-structure-gui/pom.xml +++ b/biojava-structure-gui/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT 4.0.0 biojava-structure-gui @@ -27,13 +27,13 @@ org.biojava biojava-structure - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile diff --git a/biojava-structure/pom.xml b/biojava-structure/pom.xml index da120da772..6c63cbf2d2 100644 --- a/biojava-structure/pom.xml +++ b/biojava-structure/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-structure biojava-structure @@ -40,13 +40,13 @@ org.biojava biojava-alignment - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile diff --git a/biojava-survival/pom.xml b/biojava-survival/pom.xml index 7ea9ba5a20..a3a9653424 100644 --- a/biojava-survival/pom.xml +++ b/biojava-survival/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-survival diff --git a/biojava-ws/pom.xml b/biojava-ws/pom.xml index 9dd4cd10e6..6c38dfd02e 100644 --- a/biojava-ws/pom.xml +++ b/biojava-ws/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava-ws biojava-ws @@ -19,7 +19,7 @@ org.biojava biojava-core - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT compile diff --git a/pom.xml b/pom.xml index 511ac005e9..8f01d73591 100644 --- a/pom.xml +++ b/pom.xml @@ -12,7 +12,7 @@ org.biojava biojava pom - 5.0.2-SNAPSHOT + 5.1.0-SNAPSHOT biojava BioJava is an open-source project dedicated to providing a Java framework for processing biological data. It provides analytical and statistical routines, parsers for common file formats and allows the From 523c78e1660599879e060619779d685dbd330cda Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Wed, 23 May 2018 13:27:20 -0700 Subject: [PATCH 14/37] Update readme.md --- readme.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/readme.md b/readme.md index 487f050f8b..efb31d8f41 100644 --- a/readme.md +++ b/readme.md @@ -1,6 +1,6 @@ # Welcome to -[![Build Status](https://travis-ci.org/biojava/biojava.svg?branch=master)](https://travis-ci.org/biojava/biojava) [![Version](http://img.shields.io/badge/version-5.0.0-blue.svg?style=flat)](https://github.com/biojava/biojava/releases/tag/biojava-4.2.11) [![License](http://img.shields.io/badge/license-LGPL_2.1-blue.svg?style=flat)](https://github.com/biojava/biojava/blob/master/LICENSE) [![Join the chat at https://gitter.im/biojava/biojava](https://badges.gitter.im/biojava/biojava.svg)](https://gitter.im/biojava/biojava?utm_source=badge&utm_medium=badge&utm_campaign=pr-badge&utm_content=badge) +[![Build Status](https://travis-ci.org/biojava/biojava.svg?branch=master)](https://travis-ci.org/biojava/biojava) [![Version](http://img.shields.io/badge/version-5.0.2-blue.svg?style=flat)](https://github.com/biojava/biojava/releases/tag/biojava-5.0.2) [![License](http://img.shields.io/badge/license-LGPL_2.1-blue.svg?style=flat)](https://github.com/biojava/biojava/blob/master/LICENSE) [![Join the chat at https://gitter.im/biojava/biojava](https://badges.gitter.im/biojava/biojava.svg)](https://gitter.im/biojava/biojava?utm_source=badge&utm_medium=badge&utm_campaign=pr-badge&utm_content=badge) BioJava is an open-source project dedicated to providing a Java framework for **processing biological data**. It provides analytical and statistical routines, parsers for common file formats, reference implementations of popular algorithms, and allows the manipulation of sequences and 3D structures. The goal of the biojava project is to facilitate rapid application development for bioinformatics. @@ -28,7 +28,7 @@ If you are using Maven you can add the BioJava repository by adding the followin org.biojava biojava-core - 5.0.0 + 5.0.2 From d735ca681edced7c4012fa0f17444621968da115 Mon Sep 17 00:00:00 2001 From: Maximilian Greil Date: Sat, 2 Jun 2018 01:14:42 +0200 Subject: [PATCH 15/37] #731 OBO Parser: replaced_by (#773) * Modified OBIFileHandler to parse hp.obo file with replaced_by * Requested changes * Fixed first suggestion * Fixed second suggestion * Changed Assert.assertTrue too Assert.assertEquals --- .../nbio/ontology/obo/OboFileHandler.java | 15 +- .../nbio/ontology/TestOboFileParsing.java | 27 + .../src/test/resources/ontology/hp.obo | 574 ++++++++++++++++++ 3 files changed, 611 insertions(+), 5 deletions(-) create mode 100644 biojava-ontology/src/test/resources/ontology/hp.obo diff --git a/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java b/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java index 88f78016f2..49e3c2b56c 100644 --- a/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java +++ b/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java @@ -66,6 +66,7 @@ public class OboFileHandler implements OboFileEventListener { public static final String SUBSET = "subset"; public static final String INTERSECTION_OF = "intersection_of"; public static final String NAMESPACE = "namespace"; + public static final String REPLACED_BY = "replaced_by"; public static final String ALT_ID = "alt_id"; @@ -135,6 +136,10 @@ public void newKey(String key, String value) { logger.warn("did not find ID for Term! "); return; } + if (key.equals(NAMESPACE)){ + Annotation anno = currentTerm.getAnnotation(); + anno.setProperty(NAMESPACE, value); + } else if (key.equals(NAME)){ currentTerm.setDescription(value); } else if (key.equals(DEF)){ @@ -172,10 +177,10 @@ else if (key.equals(NAME)){ Annotation anno = currentTerm.getAnnotation(); anno.setProperty(ALT_ID, value); } - else if (key.equals(NAMESPACE)){ - Annotation anno = currentTerm.getAnnotation(); - anno.setProperty(NAMESPACE, value); - } + else if (key.equals(REPLACED_BY)) { + Annotation anno = currentTerm.getAnnotation(); + anno.setProperty(REPLACED_BY, value); + } else { //logger.info("unknown key {}", key); @@ -195,4 +200,4 @@ public void newSynonym(Synonym synonym) { } } -} +} \ No newline at end of file diff --git a/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java b/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java index f519e6b483..16af1a4fce 100644 --- a/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java +++ b/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java @@ -34,6 +34,8 @@ import java.io.InputStream; import java.io.InputStreamReader; import java.util.Set; +import java.util.Iterator; +import org.biojava.nbio.ontology.utils.Annotation; public class TestOboFileParsing { @@ -56,4 +58,29 @@ public void testParsingBioSapiensOBO() throws Exception { Assert.assertTrue(keys.size() > 4000); } + @Test + public void testParsingHPOOBO() throws Exception { + OboParser parser = new OboParser(); + InputStream inStream = parser.getClass().getResourceAsStream("/ontology/hp.obo"); + + Assert.assertNotNull(inStream); + + BufferedReader oboFile = new BufferedReader ( new InputStreamReader ( inStream ) ); + + Ontology ontology; + + ontology = parser.parseOBO(oboFile, "Human_phenotype", "the Human Phenotype ontology"); + Set keys = ontology.getTerms(); + Iterator iter = keys.iterator(); + + while (iter.hasNext()){ + Term term = (Term) iter.next(); + if(term.getName().equals("HP:0000057")) { + Annotation anno = term.getAnnotation(); + Assert.assertTrue(anno.containsProperty("replaced_by")); + Assert.assertEquals("HP:0008665", anno.getProperty("replaced_by")); + } + } + } + } diff --git a/biojava-ontology/src/test/resources/ontology/hp.obo b/biojava-ontology/src/test/resources/ontology/hp.obo new file mode 100644 index 0000000000..47881d7819 --- /dev/null +++ b/biojava-ontology/src/test/resources/ontology/hp.obo @@ -0,0 +1,574 @@ +format-version: 1.2 +data-version: releases/2018-03-08 +saved-by: Peter Robinson, Sebastian Koehler, Sandra Doelken, Chris Mungall, Melissa Haendel, Nicole Vasilevsky, Monarch Initiative, et al. +subsetdef: hposlim_core "Core clinical terminology" +subsetdef: secondary_consequence "Consequence of a disorder in another organ system." +synonymtypedef: HP:0045076 "UK spelling" +synonymtypedef: HP:0045077 "abbreviation" +synonymtypedef: HP:0045078 "plural form" +synonymtypedef: layperson "layperson term" +default-namespace: human_phenotype +ontology: hp +property_value: http://purl.org/dc/elements/1.1/contributor "Chris Mungall" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Courtney Hum" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Joie Davis" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Mark Engelstad" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Melissa Haendel" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Nicole Vasilevsky" xsd:string +property_value: http://purl.org/dc/elements/1.1/contributor "Sandra Doelken" xsd:string +property_value: http://purl.org/dc/elements/1.1/creator "Peter N Robinson" xsd:string +property_value: http://purl.org/dc/elements/1.1/creator "Sebastian Koehler" xsd:string +property_value: http://purl.org/dc/elements/1.1/creator "The Human Phenotype Ontology Consortium" xsd:string +property_value: http://purl.org/dc/elements/1.1/creator "The Monarch Initiative" xsd:string +property_value: http://purl.org/dc/elements/1.1/license "see http://www.human-phenotype-ontology.org" xsd:string +property_value: http://purl.org/dc/elements/1.1/rights "Peter Robinson, Sebastian Koehler, The Human Phenotype Ontology Consortium, and The Monarch Initiative" xsd:string +property_value: http://purl.org/dc/elements/1.1/subject "Phenotypic abnormalities encountered in human disease" xsd:string +owl-axioms: Prefix(owl:=)\nPrefix(rdf:=)\nPrefix(xml:=)\nPrefix(xsd:=)\nPrefix(rdfs:=)\n\n\nOntology(\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion(rdfs:comment \"\")\nAnnotationAssertion( \"\"^^xsd:string)\n) +logical-definition-view-relation: has_part + +[Term] +id: HP:0000001 +name: All +comment: Root of all terms in the Human Phenotype Ontology. +xref: UMLS:C0444868 + +[Term] +id: HP:0000002 +name: Abnormality of body height +def: "Deviation from the norm of height with respect to that which is expected according to age and gender norms." [HPO:probinson] +synonym: "Abnormality of body height" EXACT layperson [] +xref: UMLS:C4025901 +is_a: HP:0001507 ! Growth abnormality +created_by: peter +creation_date: 2008-02-27T02:20:00Z + +[Term] +id: HP:0000003 +name: Multicystic kidney dysplasia +alt_id: HP:0004715 +def: "Multicystic dysplasia of the kidney is characterized by multiple cysts of varying size in the kidney and the absence of a normal pelvicaliceal system. The condition is associated with ureteral or ureteropelvic atresia, and the affected kidney is nonfunctional." [HPO:curators] +comment: Multicystic kidney dysplasia is the result of abnormal fetal renal development in which the affected kidney is replaced by multiple cysts and has little or no residual function. The vast majority of multicystic kidneys are unilateral. Multicystic kidney can be diagnosed on prenatal ultrasound. +synonym: "Multicystic dysplastic kidney" EXACT [] +synonym: "Multicystic kidneys" EXACT [] +synonym: "Multicystic renal dysplasia" EXACT [] +xref: MSH:D021782 +xref: SNOMEDCT_US:204962002 +xref: SNOMEDCT_US:82525005 +xref: UMLS:C3714581 +is_a: HP:0000107 ! Renal cyst + +[Term] +id: HP:0000005 +name: Mode of inheritance +alt_id: HP:0001453 +alt_id: HP:0001461 +def: "The pattern in which a particular genetic trait or disorder is passed from one generation to the next." [HPO:probinson] +synonym: "Inheritance" EXACT [] +xref: UMLS:C1708511 +is_a: HP:0000001 ! All + +[Term] +id: HP:0000006 +name: Autosomal dominant inheritance +alt_id: HP:0001415 +alt_id: HP:0001447 +alt_id: HP:0001448 +alt_id: HP:0001451 +alt_id: HP:0001455 +alt_id: HP:0001456 +alt_id: HP:0001463 +def: "A mode of inheritance that is observed for traits related to a gene encoded on one of the autosomes (i.e., the human chromosomes 1-22) in which a trait manifests in heterozygotes. In the context of medical genetics, an autosomal dominant disorder is caused when a single copy of the mutant allele is present. Males and females are affected equally, and can both transmit the disorder with a risk of 50% for each child of inheriting the mutant allele." [HPO:curators] +synonym: "Autosomal dominant" EXACT [] +synonym: "Autosomal dominant form" RELATED [HPO:skoehler] +synonym: "Autosomal dominant type" RELATED [HPO:skoehler] +xref: SNOMEDCT_US:263681008 +xref: UMLS:C0443147 +is_a: HP:0000005 ! Mode of inheritance + +[Term] +id: HP:0000007 +name: Autosomal recessive inheritance +alt_id: HP:0001416 +alt_id: HP:0001526 +def: "A mode of inheritance that is observed for traits related to a gene encoded on one of the autosomes (i.e., the human chromosomes 1-22) in which a trait manifests in homozygotes. In the context of medical genetics, autosomal recessive disorders manifest in homozygotes (with two copies of the mutant allele) or compound heterozygotes (whereby each copy of a gene has a distinct mutant allele)." [HPO:curators] +synonym: "Autosomal recessive" EXACT [] +synonym: "Autosomal recessive form" RELATED [HPO:skoehler] +synonym: "Autosomal recessive predisposition" RELATED [] +xref: SNOMEDCT_US:258211005 +xref: UMLS:C0441748 +xref: UMLS:C4020899 +is_a: HP:0000005 ! Mode of inheritance + +[Term] +id: HP:0000008 +name: Abnormality of female internal genitalia +def: "An abnormality of the female internal genitalia." [HPO:probinson] +xref: UMLS:C4025900 +is_a: HP:0000812 ! Abnormal internal genitalia +is_a: HP:0010460 ! Abnormality of the female genitalia + +[Term] +id: HP:0000009 +name: Functional abnormality of the bladder +alt_id: HP:0004424 +alt_id: HP:0008731 +def: "Dysfunction of the urinary bladder." [HPO:probinson] +synonym: "Poor bladder function" EXACT [] +xref: UMLS:C3806583 +is_a: HP:0000014 ! Abnormality of the bladder + +[Term] +id: HP:0000010 +name: Recurrent urinary tract infections +alt_id: HP:0000094 +def: "Repeated infections of the urinary tract." [HPO:probinson] +comment: The urinary tract comprises the kidneys, ureters, a bladder, and a urethra. +synonym: "Frequent urinary tract infections" EXACT layperson [] +synonym: "Urinary infection" EXACT layperson [] +synonym: "Urinary tract infection" EXACT layperson [] +synonym: "Urinary tract infections" EXACT layperson [] +synonym: "Urinary tract infections, recurrent" EXACT layperson [HPO:skoehler] +xref: SNOMEDCT_US:197927001 +xref: UMLS:C0262655 +is_a: HP:0002719 ! Recurrent infections +is_a: HP:0011277 ! Abnormality of the urinary system physiology + +[Term] +id: HP:0000011 +name: Neurogenic bladder +def: "An inability to completely empty the urinary bladder during the process of urination owing to a neurological condition." [HPO:probinson] +xref: MSH:D001750 +xref: SNOMEDCT_US:397732007 +xref: SNOMEDCT_US:398064005 +xref: UMLS:C0005697 +is_a: HP:0000009 ! Functional abnormality of the bladder + +[Term] +id: HP:0000012 +name: Urinary urgency +def: "Urge incontinence is the strong, sudden need to urinate." [HPO:probinson, pmid:12559262] +comment: Urinary urgency is the strong, sudden need to urinate and is usually due to bladder spasms or contractions. This symptom is suggestive of, but not necessarily conclusive for urodynamically demonstrable detrusor hyperactivity. +synonym: "Overactive bladder" EXACT layperson [ORCID:0000-0002-0736-9199] +synonym: "Overactive bladder syndrome" RELATED [] +synonym: "Urgency frequency syndrome" RELATED [] +synonym: "Urinary urgency" EXACT layperson [] +xref: SNOMEDCT_US:75088002 +xref: UMLS:C0085606 +xref: UMLS:C3544092 +xref: UMLS:C4020898 +is_a: HP:0000009 ! Functional abnormality of the bladder + +[Term] +id: HP:0000013 +name: Hypoplasia of the uterus +alt_id: HP:0001154 +alt_id: HP:0008637 +def: "Underdevelopment of the uterus." [HPO:probinson] +synonym: "Hypoplastic uterus" EXACT [] +synonym: "Rudimentary uterus" EXACT [] +synonym: "Small uterus" EXACT layperson [ORCID:0000-0001-5208-3432] +synonym: "Underdeveloped uterus" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: SNOMEDCT_US:35850006 +xref: UMLS:C0266399 +is_a: HP:0008684 ! Aplasia/hypoplasia of the uterus + +[Term] +id: HP:0000014 +name: Abnormality of the bladder +def: "An abnormality of the urinary bladder." [HPO:probinson] +xref: UMLS:C0149632 +is_a: HP:0010936 ! Abnormality of the lower urinary tract + +[Term] +id: HP:0000015 +name: Bladder diverticulum +def: "Diverticulum (sac or pouch) in the wall of the urinary bladder." [HPO:probinson] +synonym: "Bladder diverticula" EXACT [HPO:skoehler] +xref: MSH:C562406 +xref: SNOMEDCT_US:197866008 +xref: UMLS:C0156273 +is_a: HP:0025487 ! Abnormality of bladder morphology + +[Term] +id: HP:0000016 +name: Urinary retention +def: "Inability to completely empty the urinary bladder during the process of urination." [HPO:probinson] +comment: Urinary retention is the inability of the urinary bladder to empty. The cause may be neurologic or nonneurologic. +synonym: "Increased post-void residual urine volume" EXACT [] +xref: MSH:D016055 +xref: SNOMEDCT_US:130951007 +xref: SNOMEDCT_US:267064002 +xref: SNOMEDCT_US:449491000124101 +xref: UMLS:C0080274 +is_a: HP:0000009 ! Functional abnormality of the bladder + +[Term] +id: HP:0000017 +name: Nocturia +def: "Abnormally increased production of urine during the night leading to an unusually frequent need to urinate." [HPO:sdoelken] +comment: Often occuring as a result of heart insufficiency. +synonym: "Nycturia" EXACT [HPO:sdoelken] +xref: MSH:D053158 +xref: SNOMEDCT_US:139394000 +xref: UMLS:C0028734 +is_a: HP:0000009 ! Functional abnormality of the bladder + +[Term] +id: HP:0000019 +name: Urinary hesitancy +def: "Difficulty in beginning the process of urination." [HPO:probinson] +synonym: "Difficulty with flow" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: SNOMEDCT_US:5972002 +xref: UMLS:C0152032 +is_a: HP:0000009 ! Functional abnormality of the bladder + +[Term] +id: HP:0000020 +name: Urinary incontinence +alt_id: HP:0006942 +alt_id: HP:0008681 +def: "Loss of the ability to control the urinary bladder leading to involuntary urination." [HPO:sdoelken, pmid:12559262] +comment: Urinary incontinence can be defined as the complaint of any involuntary leakage of urine. +synonym: "Bladder incontinence" EXACT [] +synonym: "Loss of bladder control" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: MSH:D014549 +xref: SNOMEDCT_US:165232002 +xref: UMLS:C0042024 +is_a: HP:0000009 ! Functional abnormality of the bladder +is_a: HP:0031064 ! Impaired continence + +[Term] +id: HP:0000021 +name: Megacystis +alt_id: HP:0002838 +def: "Dilatation of the bladder postnatally." [HPO:probinson] +xref: MSH:C536139 +xref: UMLS:C1855311 +is_a: HP:0010955 ! Dilatation of the bladder + +[Term] +id: HP:0000022 +name: Abnormality of male internal genitalia +def: "An abnormality of the male internal genitalia." [HPO:probinson] +comment: The internal genital structures of the male including the testis, epididymis, vas deferens, seminal vesicle, ejaculatory duct, bulbourethral gland, and the prostate. +xref: UMLS:C4025899 +is_a: HP:0000812 ! Abnormal internal genitalia +is_a: HP:0010461 ! Abnormality of the male genitalia + +[Term] +id: HP:0000023 +name: Inguinal hernia +def: "Protrusion of the contents of the abdominal cavity through the inguinal canal." [HPO:probinson] +comment: Inguinal hernia appears as a bulge in the groin. +subset: hposlim_core +xref: MEDDRA:10022016 "Inguinal hernia" +xref: MSH:D006552 +xref: SNOMEDCT_US:396232000 +xref: UMLS:C0019294 +is_a: HP:0004299 ! Hernia of the abdominal wall + +[Term] +id: HP:0000024 +name: Prostatitis +def: "The presence of inflammation of the prostate." [HPO:probinson] +synonym: "Inflammation of the prostate" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: MSH:D011472 +xref: SNOMEDCT_US:9713002 +xref: UMLS:C0033581 +is_a: HP:0008775 ! Abnormality of the prostate +is_a: HP:0012649 ! Increased inflammatory response + +[Term] +id: HP:0000025 +name: Functional abnormality of male internal genitalia +xref: UMLS:C4025898 +is_a: HP:0012874 ! Abnormal male reproductive system physiology + +[Term] +id: HP:0000026 +name: Male hypogonadism +alt_id: HP:0008649 +def: "Decreased functionality of the male gonad, i.e., of the testis, with reduced spermatogenesis or testosterone synthesis." [HPO:probinson] +synonym: "Decreased function of male gonad" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: MSH:D005058 +xref: SNOMEDCT_US:48723006 +xref: UMLS:C0151721 +is_a: HP:0000025 ! Functional abnormality of male internal genitalia +is_a: HP:0000135 ! Hypogonadism + +[Term] +id: HP:0000027 +name: Azoospermia +def: "Absence of any measurable level of sperm in his semen." [HPO:probinson, pmid:20514278] +synonym: "Absent sperm in semen" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: MSH:D053713 +xref: SNOMEDCT_US:425558002 +xref: SNOMEDCT_US:48188009 +xref: UMLS:C0004509 +is_a: HP:0008669 ! Abnormal spermatogenesis + +[Term] +id: HP:0000028 +name: Cryptorchidism +alt_id: HP:0000797 +def: "Testis in inguinal canal. That is, absence of one or both testes from the scrotum owing to failure of the testis or testes to descend through the inguinal canal to the testis." [HPO:probinson, pmid:23650202] +comment: The gonad is mobile and can be retracted superiorly by the cremaster muscle reflex stimulated, for instance, by cold or touch. A retracted testis is not cryptorchidism. An abdominal testis cannot be distinguished by physical examination from an (Apparently) absent testis and requires radiological (or, rarely, surgical) procedures for assessment. +synonym: "Cryptorchism" EXACT [ORCID:0000-0001-5208-3432] +synonym: "Undescended testes" EXACT layperson [] +synonym: "Undescended testis" EXACT layperson [] +xref: Fyler:4493 +xref: MSH:D003456 +xref: SNOMEDCT_US:204878001 +xref: UMLS:C0010417 +is_a: HP:0000035 ! Abnormality of the testis + +[Term] +id: HP:0000029 +name: Testicular atrophy +def: "Wasting (atrophy) of the testicle (the male gonad) manifested by a decrease in size and potentially by a loss of fertility." [HPO:probinson] +synonym: "Testicular degeneration" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: SNOMEDCT_US:17585008 +xref: UMLS:C0156312 +is_a: HP:0000035 ! Abnormality of the testis + +[Term] +id: HP:0000030 +name: Testicular gonadoblastoma +def: "The presence of a gonadoblastoma of the testis." [HPO:probinson] +synonym: "Gonadoblastoma, male" RELATED [] +xref: UMLS:C1515283 +is_a: HP:0000150 ! Gonadoblastoma +is_a: HP:0010788 ! Testicular neoplasm + +[Term] +id: HP:0000031 +name: Epididymitis +def: "The presence of inflammation of the epididymis." [HPO:probinson] +xref: MSH:D004823 +xref: SNOMEDCT_US:31070006 +xref: UMLS:C0014534 +is_a: HP:0009714 ! Abnormality of the epididymis +is_a: HP:0012649 ! Increased inflammatory response + +[Term] +id: HP:0000032 +name: Abnormality of male external genitalia +def: "An abnormality of male external genitalia." [HPO:probinson] +xref: UMLS:C4025897 +is_a: HP:0000811 ! Abnormal external genitalia +is_a: HP:0010461 ! Abnormality of the male genitalia + +[Term] +id: HP:0000033 +name: Ambiguous genitalia, male +def: "Ambiguous genitalia in an individual with XY genetic gender." [HPO:probinson] +synonym: "Ambiguous genitalia in males" EXACT layperson [] +xref: UMLS:C4021823 +is_a: HP:0000032 ! Abnormality of male external genitalia +is_a: HP:0000062 ! Ambiguous genitalia + +[Term] +id: HP:0000034 +name: Hydrocele testis +def: "Accumulation of clear fluid in the between the layers of membrane (tunica vaginalis) surrounding the testis." [HPO:probinson] +synonym: "Hydrocele" BROAD [] +synonym: "Testicular hydrocele" EXACT [] +xref: MSH:D006848 +xref: SNOMEDCT_US:26614003 +xref: SNOMEDCT_US:386152007 +xref: SNOMEDCT_US:55434001 +xref: UMLS:C1720771 +is_a: HP:0000035 ! Abnormality of the testis + +[Term] +id: HP:0000035 +name: Abnormality of the testis +def: "An anomaly of the testicle (the male gonad)." [HPO:probinson] +synonym: "Abnormality of the testis" EXACT layperson [] +synonym: "Anomaly of the testes" EXACT [] +xref: SNOMEDCT_US:55631001 +xref: UMLS:C0266423 +is_a: HP:0000032 ! Abnormality of male external genitalia + +[Term] +id: HP:0000036 +name: Abnormality of the penis +synonym: "Abnormality of the penis" EXACT layperson [] +xref: UMLS:C4025896 +is_a: HP:0000032 ! Abnormality of male external genitalia + +[Term] +id: HP:0000037 +name: Male pseudohermaphroditism +def: "Hermaphroditism refers to a discrepancy between the morphology of the gonads and that of the external genitalia. In male pseudohermaphroditism, the genotype is male (XY) and the external genitalia are imcompletely virilized, ambiguous, or complete female. If gonads are present, they are testes." [HPO:curators] +xref: MSH:D058490 +xref: SNOMEDCT_US:111332007 +xref: UMLS:C0238395 +is_a: HP:0000032 ! Abnormality of male external genitalia + +[Term] +id: HP:0000039 +name: Epispadias +def: "Displacement of the urethral opening on the dorsal (superior) surface of the penis." [HPO:probinson, pmid:23650202] +comment: Epispadias may be present in a phenotypic male, female, or an individual with ambiguous genitalia. A meatus in a phenotypic male may be positioned either on the glans (glandular or balanic epispadias), the shaft (penile epispadias) or at the attachment of the penis to the abdominal wall (penopubic epispadias). Alternatively, the urethra may be an open groove along the dorsal shaft of the penis, with no readily recognized meatus. Epispadias is a frequent component of Bladder exstrophy, but should be coded separately. +xref: SNOMEDCT_US:406477003 +xref: UMLS:C0563449 +is_a: HP:0100627 ! Displacement of the external urethral meatus + +[Term] +id: HP:0000040 +name: Long penis +def: "Penile length more than 2 SD above the mean for age." [] +comment: Penile length is the distance between the midline attachment of the gently stretched, flaccid penis above the pubic symphysis and tip of the glans. +synonym: "Enlarged penis" EXACT layperson [] +synonym: "Long penis" EXACT layperson [] +xref: SNOMEDCT_US:88673001 +xref: UMLS:C0269011 +is_a: HP:0000036 ! Abnormality of the penis + +[Term] +id: HP:0000041 +name: Chordee +def: "Ventral, lateral, or ventrolateral bowing of the shaft and glans penis of more than 30 degrees." [HPO:probinson, pmid:23650202] +comment: The degree of variation of penis curvature is a continuum, but traditionally 30 degrees is considered the threshold for surgical intervention on chordee. Bowing usually becomes more obvious in an erect penis, but is frequently also palpable when stretching a flaccid penis. Chordee can be congenital or acquired; if the former, it can be associated with Webbed Penis or Hypospadias, which should be coded separately. +xref: SNOMEDCT_US:4287008 +xref: UMLS:C0221182 +is_a: HP:0000036 ! Abnormality of the penis + +[Term] +id: HP:0000042 +name: Absent external genitalia +def: "Lack of external genitalia in a male or female individual." [HPO:probinson] +synonym: "Absent external genitalia" EXACT layperson [] +xref: UMLS:C1848869 +is_a: HP:0000811 ! Abnormal external genitalia + +[Term] +id: HP:0000044 +name: Hypogonadotrophic hypogonadism +alt_id: HP:0003335 +alt_id: HP:0008224 +def: "Hypogonadotropic hypogonadism is characterized by reduced function of the gonads (testes in males or ovaries in females) and results from the absence of the gonadal stimulating pituitary hormones: follicle stimulating hormone (FSH) and luteinizing hormone (LH)." [HPO:probinson] +synonym: "Hypogonadism, hypogonadotropic" EXACT [] +synonym: "Isolated hypogonadotropic hypogonadism" RELATED [] +synonym: "Low gonadotropins (secondary hypogonadism)" EXACT [] +xref: MSH:D007006 +xref: SNOMEDCT_US:33927004 +xref: UMLS:C0271623 +xref: UMLS:C3489396 +is_a: HP:0000135 ! Hypogonadism + +[Term] +id: HP:0000045 +name: Abnormality of the scrotum +xref: UMLS:C4025895 +is_a: HP:0000032 ! Abnormality of male external genitalia + +[Term] +id: HP:0000046 +name: Scrotal hypoplasia +synonym: "Hypoplastic scrotum" EXACT [] +xref: SNOMEDCT_US:204912007 +xref: UMLS:C0431659 +is_a: HP:0000045 ! Abnormality of the scrotum +is_a: HP:0000050 ! Hypoplastic male external genitalia + +[Term] +id: HP:0000047 +name: Hypospadias +def: "Abnormal position of urethral meatus on the ventral penile shaft (underside) characterized by displacement of the urethral meatus from the tip of the glans penis to the ventral surface of the penis, scrotum, or perineum." [HPO:probinson, PMID:21968448] +synonym: "Hypospadia" EXACT [ORCID:0000-0001-5208-3432] +xref: Fyler:4504 +xref: SNOMEDCT_US:204888000 +xref: UMLS:C1691215 +is_a: HP:0100627 ! Displacement of the external urethral meatus + +[Term] +id: HP:0000048 +name: Bifid scrotum +def: "Midline indentation or cleft of the scrotum." [HPO:probinson, pmid:23650202] +comment: A testis may or may not be present in each half of the scrotum. +synonym: "Cleft of scrotum" EXACT layperson [ORCID:0000-0001-5208-3432] +synonym: "Scrotal cleft" EXACT [] +xref: SNOMEDCT_US:236780002 +xref: UMLS:C0341787 +is_a: HP:0000045 ! Abnormality of the scrotum + +[Term] +id: HP:0000049 +name: Shawl scrotum +def: "Superior margin of the scrotum superior to the base of the penis." [HPO:probinson, pmid:23650202] +comment: A congenital overriding scrotum may disappear with growth and development, especially during puberty. If the entire scrotum is located superior to the penis, the term Penoscrotal transposition is used instead. +synonym: "Overriding scrotum" EXACT [] +xref: UMLS:C1858539 +is_a: HP:0000045 ! Abnormality of the scrotum + +[Term] +id: HP:0000050 +name: Hypoplastic male external genitalia +alt_id: HP:0008710 +alt_id: HP:0008721 +def: "Underdevelopment of part or all of the male external reproductive organs (which include the penis, the scrotum and the urethra)." [HPO:probinson] +synonym: "Hypoplastic male genitalia" EXACT [] +synonym: "Small male external genitalia" EXACT layperson [] +synonym: "Underdeveloped male genitalia" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: UMLS:C1852534 +is_a: HP:0003241 ! External genital hypoplasia + +[Term] +id: HP:0000051 +name: Perineal hypospadias +def: "Hypospadias with location of the urethral meatus in the perineal region." [HPO:probinson, pmid:8097257] +xref: SNOMEDCT_US:204890004 +xref: UMLS:C0452148 +is_a: HP:0000047 ! Hypospadias + +[Term] +id: HP:0000052 +name: Urethral atresia, male +def: "Congenital anomaly characterized by closure or failure to develop an opening in the urethra in males." [HPO:probinson] +xref: UMLS:C4025894 +is_a: HP:0000068 ! Urethral atresia + +[Term] +id: HP:0000053 +name: Macroorchidism +def: "The presence of abnormally large testes." [HPO:probinson] +synonym: "Large testicles" EXACT [] +synonym: "Large testis" EXACT layperson [] +xref: UMLS:C1263023 +is_a: HP:0045058 ! Abnormality of the testis size + +[Term] +id: HP:0000054 +name: Micropenis +alt_id: HP:0000038 +def: "Abnormally small penis. At birth, the normal penis is about 3 cm (stretched length from pubic tubercle to tip of penis) with micropenis less than 2.0-2.5 cm." [HPO:probinson, pmid:15102623] +synonym: "Short penis" EXACT layperson [] +synonym: "Small penis" EXACT layperson [] +xref: SNOMEDCT_US:34911001 +xref: UMLS:C0266435 +is_a: HP:0008736 ! Hypoplasia of penis + +[Term] +id: HP:0000055 +name: Abnormality of female external genitalia +def: "An abnormality of the female external genitalia." [HPO:probinson] +synonym: "Abnormal female external genitalia" EXACT layperson [HPO:skoehler] +xref: UMLS:C4021822 +is_a: HP:0000811 ! Abnormal external genitalia +is_a: HP:0010460 ! Abnormality of the female genitalia + +[Term] +id: HP:0000056 +name: Abnormality of the clitoris +def: "An abnormality of the clitoris." [HPO:probinson] +synonym: "Abnormality of the clit" EXACT layperson [ORCID:0000-0001-5208-3432] +xref: UMLS:C4025893 +is_a: HP:0000055 ! Abnormality of female external genitalia + +[Term] +id: HP:0000057 +name: obsolete Clitoromegaly +is_obsolete: true +replaced_by: HP:0008665 \ No newline at end of file From fd4f8ef29c25d6329c903687c08d78c6c03a8a76 Mon Sep 17 00:00:00 2001 From: Spencer Bliven Date: Fri, 15 Jun 2018 13:17:42 +0200 Subject: [PATCH 16/37] Fix test failure due to PDB change 4LNC was updated to remove the X-Ray experimental method. This switches the test to 6F2Q, which uses both Neutron & Xray. --- .../biojava/nbio/structure/TestExperimentalTechniques.java | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java index f9915e47db..25436297a6 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java @@ -31,7 +31,7 @@ public class TestExperimentalTechniques { @Test - public void test4LNC() throws IOException, StructureException { + public void test6F2Q() throws IOException, StructureException { // a multiple experimental techniques PDB entry (X-RAY + NEUTRON DIFFRACTION) @@ -40,9 +40,9 @@ public void test4LNC() throws IOException, StructureException { StructureIO.setAtomCache(cache); cache.setUseMmCif(false); - Structure sPdb = StructureIO.getStructure("4LNC"); + Structure sPdb = StructureIO.getStructure("6F2Q"); cache.setUseMmCif(true); - Structure sCif = StructureIO.getStructure("4LNC"); + Structure sCif = StructureIO.getStructure("6F2Q"); comparePdbToCif(sPdb, sCif); From f9fe526e776d9add52b521876e95cae1130dffef Mon Sep 17 00:00:00 2001 From: Jose Duarte Date: Sat, 23 Jun 2018 19:34:30 -0700 Subject: [PATCH 17/37] Some fixes in altloc test and 2 additions --- .../biojava/nbio/structure/TestAltLocs.java | 199 +++++++++++++++--- 1 file changed, 168 insertions(+), 31 deletions(-) diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java index 55719fa305..8b55e9f099 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java @@ -23,13 +23,19 @@ import org.biojava.nbio.structure.align.util.AtomCache; import org.biojava.nbio.structure.io.FileParsingParameters; import org.biojava.nbio.structure.io.mmcif.ChemCompGroupFactory; +import org.biojava.nbio.structure.io.mmcif.MMCIFFileTools; +import org.biojava.nbio.structure.io.mmcif.SimpleMMcifConsumer; +import org.biojava.nbio.structure.io.mmcif.SimpleMMcifParser; import org.biojava.nbio.structure.io.mmcif.chem.PolymerType; import org.biojava.nbio.structure.io.mmcif.chem.ResidueType; +import org.biojava.nbio.structure.io.mmcif.model.AtomSite; import org.biojava.nbio.structure.io.mmcif.model.ChemComp; import org.biojava.nbio.structure.io.mmcif.model.ChemCompBond; import org.junit.Test; +import java.io.BufferedReader; import java.io.IOException; +import java.io.StringReader; import java.util.ArrayList; import java.util.List; @@ -85,7 +91,7 @@ public void testAltLocParsing() throws StructureException, IOException{ assertTrue("The group does not have an altLoc ", g.hasAltLoc()); - assertTrue("The nr of altLocs is not 1, but " + g.getAltLocs().size(), g.getAltLocs().size() == 1); + assertEquals(1, g.getAltLocs().size()); assertEquals( g.getPDBName(), "KOR"); @@ -93,20 +99,18 @@ public void testAltLocParsing() throws StructureException, IOException{ assertEquals(altLocG.getPDBName(),"K1R"); - assertEquals(275,groupCount); + assertEquals(275, groupCount); // citric acid is now in its own chain Chain b = s.getChain("B"); - assertTrue(b.getAtomGroups().size() == 1); - + assertEquals(1, b.getAtomGroups().size()); ResidueNumber resNum2 = ResidueNumber.fromString("265"); Group g2 = a.getGroupByPDB(resNum2); assertTrue(g2.hasAltLoc()); - } @Test @@ -127,8 +131,7 @@ public void test2W72() throws IOException, StructureException{ Atom[] caA = StructureTools.getRepresentativeAtomArray(a); - assertEquals(caA.length,141); - + assertEquals(141, caA.length); } @@ -148,7 +151,6 @@ public void test1U7F() throws IOException, StructureException{ ensureAllAtomsSameAltCode(altGroup, g); } - } @Test @@ -166,7 +168,6 @@ public void test1JXX() throws IOException, StructureException{ ensureAllAtomsSameAltCode(altGroup, g); } - } @@ -208,6 +209,10 @@ private void ensureAllAtomsSameAltCode(Group groupInputAltLocGroup, Group inputM @Test public void test1AAC() throws IOException, StructureException{ + AtomCache cache = new AtomCache(); + cache.setUseMmCif(false); + StructureIO.setAtomCache(cache); + Structure s = StructureIO.getStructure("1AAC"); Chain a = s.getPolyChainByPDB("A"); @@ -215,8 +220,9 @@ public void test1AAC() throws IOException, StructureException{ Group g = a.getGroupByPDB( ResidueNumber.fromString("27")); testCBAtomInMainGroup(g); - AtomCache cache = new AtomCache(); + cache = new AtomCache(); cache.setUseMmCif(true); + StructureIO.setAtomCache(cache); Structure s1 = cache.getStructure("1AAC"); Chain a1 = s1.getPolyChainByPDB("A"); @@ -225,20 +231,6 @@ public void test1AAC() throws IOException, StructureException{ testCBAtomInMainGroup(g1); - - - // int pos = 0; - // for (Group alt: g.getAltLocs()) { - // pos++; - // System.out.println("altLoc: " + pos + " " + alt); - // for (Atom atom : alt.getAtoms()) { - // System.out.print(atom.toPDB()); - // } - // } - - - - } private void testCBAtomInMainGroup(Group g) { @@ -248,7 +240,7 @@ private void testCBAtomInMainGroup(Group g) { for (Atom atom : g.getAtoms()) { //System.out.print(atom.toPDB()); - if ( atom.getName().equals(StructureTools.CA_ATOM_NAME)){ + if ( atom.getName().equals(StructureTools.CB_ATOM_NAME)){ cbInMain = true; break; @@ -316,7 +308,7 @@ public void test3PIUpdb() throws IOException, StructureException{ } } - assertTrue(ca.length == caList.size()); + assertEquals(ca.length, caList.size()); } @@ -354,7 +346,7 @@ private void doTestAllAltLocsSamAtomsMainGroup(String pdbId) throws IOException, for (Group g: c.getAtomGroups()){ for (Group altLocGroup:g.getAltLocs()) { - assertEquals(altLocGroup.size(), g.size()); + assertEquals(g.size(), altLocGroup.size()); } } } @@ -482,7 +474,7 @@ public void test4CUPBonds() throws IOException, StructureException{ } } - assertTrue(ca.length == caList.size()); + assertEquals(ca.length, caList.size()); } @@ -534,7 +526,6 @@ public void test3PIUmmcif() throws IOException, StructureException{ } - } if (! caInMain && g.hasAtom(StructureTools.CA_ATOM_NAME)){ // g.hasAtom checks altLocs @@ -546,7 +537,6 @@ public void test3PIUmmcif() throws IOException, StructureException{ assertEquals(ca.length, caList.size()); - } @Test @@ -592,7 +582,6 @@ public void test3U7Tmmcif() throws IOException, StructureException{ } - } if (! caInMain && g.hasAtom(StructureTools.CA_ATOM_NAME)){ // g.hasAtom checks altLocs @@ -604,6 +593,154 @@ public void test3U7Tmmcif() throws IOException, StructureException{ assertEquals(ca.length, caList.size()); + } + + @Test + public void testMmcifWritingPartialAltlocs() throws IOException { + String mmcifData = + "data_test\n" + + "loop_\n" + + "_atom_site.group_PDB \n" + + "_atom_site.id \n" + + "_atom_site.type_symbol \n" + + "_atom_site.label_atom_id \n" + + "_atom_site.label_alt_id \n" + + "_atom_site.label_comp_id \n" + + "_atom_site.label_asym_id \n" + + "_atom_site.label_entity_id \n" + + "_atom_site.label_seq_id \n" + + "_atom_site.pdbx_PDB_ins_code \n" + + "_atom_site.Cartn_x \n" + + "_atom_site.Cartn_y \n" + + "_atom_site.Cartn_z \n" + + "_atom_site.occupancy \n" + + "_atom_site.B_iso_or_equiv \n" + + "_atom_site.pdbx_formal_charge \n" + + "_atom_site.auth_seq_id \n" + + "_atom_site.auth_comp_id \n" + + "_atom_site.auth_asym_id \n" + + "_atom_site.auth_atom_id \n" + + "_atom_site.pdbx_PDB_model_num \n" + + "ATOM 102 N N . ARG A 1 13 ? 9.889 23.379 13.115 1.00 6.57 ? 102 ARG A N 1\n" + + "ATOM 103 C CA . ARG A 1 13 ? 9.540 23.003 14.482 1.00 7.05 ? 102 ARG A CA 1\n" + + "ATOM 104 C C . ARG A 1 13 ? 10.407 23.758 15.489 1.00 6.88 ? 102 ARG A C 1\n" + + "ATOM 105 O O . ARG A 1 13 ? 9.915 24.196 16.532 1.00 7.69 ? 102 ARG A O 1\n" + + "ATOM 106 C CB . ARG A 1 13 ? 9.706 21.494 14.688 1.00 9.07 ? 102 ARG A CB 1\n" + + "ATOM 107 C CG A ARG A 1 13 ? 8.757 20.644 13.854 0.50 14.39 ? 102 ARG A CG 1\n" + + "ATOM 108 C CG B ARG A 1 13 ? 8.693 20.645 13.938 0.50 13.58 ? 102 ARG A CG 1\n" + + "ATOM 109 C CD A ARG A 1 13 ? 9.109 19.164 13.950 0.50 18.14 ? 102 ARG A CD 1\n" + + "ATOM 110 C CD B ARG A 1 13 ? 8.710 19.216 14.456 0.50 16.34 ? 102 ARG A CD 1\n" + + "ATOM 111 N NE A ARG A 1 13 ? 8.983 18.644 15.310 0.50 20.72 ? 102 ARG A NE 1\n" + + "ATOM 112 N NE B ARG A 1 13 ? 8.315 19.158 15.861 0.50 23.99 ? 102 ARG A NE 1\n" + + "ATOM 113 C CZ A ARG A 1 13 ? 7.826 18.445 15.933 0.50 23.45 ? 102 ARG A CZ 1\n" + + "ATOM 114 C CZ B ARG A 1 13 ? 8.404 18.072 16.622 0.50 24.56 ? 102 ARG A CZ 1\n" + + "ATOM 115 N NH1 A ARG A 1 13 ? 6.683 18.718 15.321 0.50 23.60 ? 102 ARG A NH1 1\n" + + "ATOM 116 N NH1 B ARG A 1 13 ? 8.881 16.942 16.118 0.50 28.42 ? 102 ARG A NH1 1\n" + + "ATOM 117 N NH2 A ARG A 1 13 ? 7.812 17.972 17.172 0.50 24.80 ? 102 ARG A NH2 1\n" + + "ATOM 118 N NH2 B ARG A 1 13 ? 8.013 18.115 17.888 0.50 26.52 ? 102 ARG A NH2 1\n"; + + SimpleMMcifParser parser = new SimpleMMcifParser(); + SimpleMMcifConsumer consumer = new SimpleMMcifConsumer(); + parser.addMMcifConsumer(consumer); + + BufferedReader buf = new BufferedReader(new StringReader(mmcifData)); + parser.parse(buf); + buf.close(); + + Structure s = consumer.getStructure(); + Chain c = s.getPolyChains().get(0); + assertEquals(1, c.getAtomGroups().size()); + Group g = c.getAtomGroup(0); + assertEquals(11, g.size()); + assertEquals(1, g.getAltLocs().size()); + + for (Atom a : g.getAtoms()) { + if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB")) + assertEquals(' ', a.getAltLoc().charValue()); + else + assertEquals('A', a.getAltLoc().charValue()); + } + + assertEquals(11, g.getAltLocs().get(0).size()); + for (Atom a : g.getAltLocs().get(0).getAtoms()) { + if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB")) + assertEquals(' ', a.getAltLoc().charValue()); + else + assertEquals('B', a.getAltLoc().charValue()); + } + + List atomSites = MMCIFFileTools.convertChainToAtomSites(c, 1, "A", "A"); + assertEquals(17, atomSites.size()); + + } + + @Test + public void testMmcifWritingAllAltlocs() throws IOException { + String mmcifData = + "data_test\n" + + "loop_\n" + + "_atom_site.group_PDB \n" + + "_atom_site.id \n" + + "_atom_site.type_symbol \n" + + "_atom_site.label_atom_id \n" + + "_atom_site.label_alt_id \n" + + "_atom_site.label_comp_id \n" + + "_atom_site.label_asym_id \n" + + "_atom_site.label_entity_id \n" + + "_atom_site.label_seq_id \n" + + "_atom_site.pdbx_PDB_ins_code \n" + + "_atom_site.Cartn_x \n" + + "_atom_site.Cartn_y \n" + + "_atom_site.Cartn_z \n" + + "_atom_site.occupancy \n" + + "_atom_site.B_iso_or_equiv \n" + + "_atom_site.pdbx_formal_charge \n" + + "_atom_site.auth_seq_id \n" + + "_atom_site.auth_comp_id \n" + + "_atom_site.auth_asym_id \n" + + "_atom_site.auth_atom_id \n" + + "_atom_site.pdbx_PDB_model_num \n" + + "ATOM 204 N N A PRO A 1 23 ? 15.057 31.425 23.772 0.50 3.09 ? 112 PRO A N 1 \n" + + "ATOM 205 N N B PRO A 1 23 ? 14.762 31.778 23.217 0.50 15.25 ? 112 PRO A N 1 \n" + + "ATOM 206 C CA A PRO A 1 23 ? 16.391 30.930 23.416 0.50 5.82 ? 112 PRO A CA 1 \n" + + "ATOM 207 C CA B PRO A 1 23 ? 16.049 31.406 22.622 0.50 15.44 ? 112 PRO A CA 1 \n" + + "ATOM 208 C C A PRO A 1 23 ? 17.360 30.580 24.546 0.50 6.73 ? 112 PRO A C 1 \n" + + "ATOM 209 C C B PRO A 1 23 ? 16.971 30.922 23.734 0.50 15.04 ? 112 PRO A C 1 \n" + + "ATOM 210 O O A PRO A 1 23 ? 18.566 30.784 24.409 0.50 10.00 ? 112 PRO A O 1 \n" + + "ATOM 211 O O B PRO A 1 23 ? 18.076 31.430 23.925 0.50 14.61 ? 112 PRO A O 1 \n" + + "ATOM 212 C CB A PRO A 1 23 ? 16.931 32.050 22.542 0.50 8.38 ? 112 PRO A CB 1 \n" + + "ATOM 213 C CB B PRO A 1 23 ? 16.519 32.710 21.986 0.50 14.09 ? 112 PRO A CB 1 \n" + + "ATOM 214 C CG A PRO A 1 23 ? 16.424 33.256 23.263 0.50 7.59 ? 112 PRO A CG 1 \n" + + "ATOM 215 C CG B PRO A 1 23 ? 15.960 33.743 22.908 0.50 15.66 ? 112 PRO A CG 1 \n" + + "ATOM 216 C CD A PRO A 1 23 ? 14.980 32.886 23.580 0.50 6.98 ? 112 PRO A CD 1 \n" + + "ATOM 217 C CD B PRO A 1 23 ? 14.558 33.235 23.153 0.50 14.91 ? 112 PRO A CD 1 \n"; + + SimpleMMcifParser parser = new SimpleMMcifParser(); + SimpleMMcifConsumer consumer = new SimpleMMcifConsumer(); + parser.addMMcifConsumer(consumer); + + BufferedReader buf = new BufferedReader(new StringReader(mmcifData)); + parser.parse(buf); + buf.close(); + + Structure s = consumer.getStructure(); + Chain c = s.getPolyChains().get(0); + assertEquals(1, c.getAtomGroups().size()); + + Group g = c.getAtomGroup(0); + assertEquals(7, g.size()); + + assertEquals(1, g.getAltLocs().size()); + + for (Atom a : g.getAtoms()) { + assertEquals('A', a.getAltLoc().charValue()); + } + for (Atom a : g.getAltLocs().get(0).getAtoms()) { + assertEquals('B', a.getAltLoc().charValue()); + } + + List atomSites = MMCIFFileTools.convertChainToAtomSites(c, 1, "A", "A"); + assertEquals(14, atomSites.size()); } From b8dfe507a0b14a355a8483cadd0ce3cd0c277aa5 Mon Sep 17 00:00:00 2001 From: Jose Duarte Date: Sun, 24 Jun 2018 15:58:16 -0700 Subject: [PATCH 18/37] Fixing issue with duplicate altlocs in writing to mmcif. Improved docs. --- .../org/biojava/nbio/structure/Group.java | 87 ++++++++++++++----- .../nbio/structure/StructureTools.java | 16 ++-- .../structure/io/mmcif/MMCIFFileTools.java | 23 ++--- .../io/mmcif/SimpleMMcifConsumer.java | 1 - .../biojava/nbio/structure/TestAltLocs.java | 12 ++- 5 files changed, 94 insertions(+), 45 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java index dded705625..19d4007863 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java @@ -64,13 +64,14 @@ public interface Group extends Serializable { public int size(); /** - * Return true or false, depending if this group has 3D coordinates or not. + * Return true or false, depending if this group has 3D coordinates or not. * * @return true if Group has 3D coordinates */ public boolean has3D (); - /** Flag if group has 3D data . + /** + * Flag if group has 3D data . * * @param flag true to set flag that this Group has 3D coordinates */ @@ -84,13 +85,15 @@ public interface Group extends Serializable { */ public GroupType getType(); - /** Add an atom to this group. + /** + * Add an atom to this group. * * @param atom an Atom object */ public void addAtom(Atom atom); - /** Get list of atoms. + /** + * Get list of atoms. * * @return a List object representing the atoms * @see #setAtoms(List) @@ -98,7 +101,8 @@ public interface Group extends Serializable { public List getAtoms() ; - /** Set the atoms of this group. + /** + * Set the atoms of this group. * @see {@link Atom} * @param atoms a list of atoms */ @@ -180,21 +184,24 @@ public interface Group extends Serializable { public boolean hasAminoAtoms() ; - /** tests in the Chemical Component Dictionary, if this group is a polymeric group + /** + * Check if this group is a polymeric group, from the definition in Chemical Component Dictionary * * @return true if a polymeric group */ public boolean isPolymeric(); - /** Tests in the Chemical Component Dictionary, if this group is an amino acid + /** + * Check if this group is an aminoacid group, from the definition in Chemical Component Dictionary * * @return true if an amino acid */ public boolean isAminoAcid(); - /** Tests in the Chemical Component Dictionary, if this group is a nucleotide + /** + * Check if this group is a nucleotide group, from the definition in Chemical Component Dictionary * * @return true if a nucleotide */ @@ -213,23 +220,25 @@ public interface Group extends Serializable { */ public void setProperties(Map properties) ; - /** return properties. + /** + * Return properties. * @see #setProperties * * @return a HashMap object representing the properties value */ public Map getProperties() ; - /** set a single property . + /** + * Set a single property . * * @param key a String * @param value an Object * @see #getProperty - */ public void setProperty(String key, Object value) ; - /** get a single property . + /** + * Get a single property . * * @param key a String * @return an Object @@ -237,14 +246,16 @@ public interface Group extends Serializable { */ public Object getProperty(String key) ; - /** get an Atom Iterator. + /** + * Get an Atom Iterator. * * @return an Iterator object */ public Iterator iterator() ; - /** returns and identical copy of this Group object . + /** + * Returns and identical copy of this Group object . * @return and identical copy of this Group object */ public Object clone(); @@ -267,7 +278,7 @@ public interface Group extends Serializable { public Chain getChain() ; /** - * returns a dynamically created ResidueNumber for the group - this + * Returns a dynamically created ResidueNumber for the group - this * contains the chainId, resNum and insCode of the group. * @see ResidueNumber * @return ResidueNumber for the group. @@ -276,13 +287,15 @@ public interface Group extends Serializable { public ResidueNumber getResidueNumber(); - /** sets the ResidueNumber for this Group + /** + * Sets the ResidueNumber for this Group * * @param residueNumber the PDB residueNumber */ public void setResidueNumber(ResidueNumber residueNumber); - /** Utility method to temporarily set a chainID for a group, if a parent chain object does not exist yet. + /** + * Utility method to temporarily set a chainID for a group, if a parent chain object does not exist yet. * Not recommended for general use other than parsing. * * @param chainId @@ -301,41 +314,66 @@ public interface Group extends Serializable { */ public String getChainId(); - /** Set the Chemical Component that closer describes this group. + /** + * Set the Chemical Component that closer describes this group. * * @param cc the chemical component */ public void setChemComp(ChemComp cc); - /** Get the chemical component that closer describes this group. If the information does not exist yet, fetches the information from PDB web site. + /** + * Get the chemical component that closer describes this group. If the information does not exist yet, fetches the information from PDB web site. * * @return the Chemical Component definition for this Group. */ public ChemComp getChemComp(); - /** Test if this group has alternate locations. + /** + * Check if this group has alternate location groups. * * @return boolean flag if there are alternate locations. + * @see #getAltLocs() */ public boolean hasAltLoc(); - /** Get the list of alternate locations. + /** + * Get the list of other alternate location groups. + *

+ * The main group (this group) will contain the first altloc (be it the default '.' or 'A' or a mix of '.' and 'A'). + *

+ * This method will return the altloc groups that are not the main group, e.g.: + * + *

  • if '.' (default), 'A' and 'B' altlocs are present in file, the main group will contain + * the default '.' and this method will return 2 altloc groups + *
  • + * + *
  • if 'A' and 'B' are present in file without a default '.' group, then the main group will contain the 'A' + * location whilst this method will return only 1 altloc group with the 'B' location + *
  • + * + *

    + * Note that all groups (main and altlocs) will contain all atoms, thus atoms from the default group + * can appear duplicated in main and altloc groups. + *

    + * Thus it can happen that an altloc group duplicate the contents of the main group. * * @return List of other groups that are on alternate locations */ public List getAltLocs(); - /** Add a group that is an alternate location for this group. + /** + * Add a group that is an alternate location for this group. * + * @param g the altloc group to add */ public void addAltLoc(Group g); /** * Determines if this group is water. * - * @see {@link GroupType#WATERNAMES} + * @see GroupType#WATERNAMES * @return true if it's water, false otherwise. */ public boolean isWater(); @@ -349,7 +387,8 @@ public interface Group extends Serializable { public Group getAltLocGroup(Character altLoc); - /** attempts to reduce the memory imprint of this group by trimming + /** + * Attempts to reduce the memory imprint of this group by trimming * all internal Collection objects to the required size. * */ diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java index e96bb2eb0a..58c777dde0 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java @@ -1842,7 +1842,8 @@ public static boolean isChainWaterOnly(Chain c) { return c.isWaterOnly(); } - /** @deprecated use {@link Chain#isPureNonPolymer()} instead. + /** + * @deprecated use {@link Chain#isPureNonPolymer()} instead. */ @Deprecated public static boolean isChainPureNonPolymer(Chain c) { @@ -1851,8 +1852,9 @@ public static boolean isChainPureNonPolymer(Chain c) { } /** - * Cleans up the structure's alternate location groups. All alternate location groups should have all atoms (except in the case of microheterogenity) or when a deuetuim exiss. - * Ensure that all the alt loc groups have all the atoms in the main group + * Cleans up the structure's alternate location (altloc) groups. All alternate location groups should have all atoms (except + * in the case of microheterogenity) or when a deuterium exists. + * Ensure that all the alt loc groups have all the atoms in the main group. * @param structure The Structure to be cleaned up */ public static void cleanUpAltLocs(Structure structure) { @@ -1866,10 +1868,7 @@ public static void cleanUpAltLocs(Structure structure) { // Fix for microheterogenity if (altLocGroup.getPDBName().equals(group.getPDBName())) { // If it's a Hydrogen then we check for it's Deuterated brother - if(hasDeuteratedEquiv(groupAtom, altLocGroup)){ - - } - else{ + if(!hasDeuteratedEquiv(groupAtom, altLocGroup)){ altLocGroup.addAtom(groupAtom); } } @@ -1896,7 +1895,7 @@ public static boolean hasNonDeuteratedEquiv(Atom atom, Group currentGroup) { } /** - * Check to see if a Hydorgen has a Deuterated brother in the group. + * Check to see if a Hydrogen has a Deuterated brother in the group. * @param atom the input atom that is putatively hydorgen * @param currentGroup the group the atom is in * @return true if the atom is hydrogen and it's Deuterium equiv exists. @@ -1915,4 +1914,5 @@ private static String replaceFirstChar(String name, char c, char d) { } return name; } + } diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java index da5f29d569..8e29983eb2 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java @@ -22,9 +22,7 @@ import java.lang.reflect.Field; -import java.util.ArrayList; -import java.util.Arrays; -import java.util.List; +import java.util.*; import org.biojava.nbio.structure.Atom; import org.biojava.nbio.structure.Chain; @@ -434,26 +432,29 @@ record = "ATOM"; */ private static List convertGroupToAtomSites(Group g, int model, String chainId, String internalChainId) { - List list = new ArrayList(); + // The alt locs can have duplicates, since at parsing time we make sure that all alt loc groups have + // all atoms (see StructureTools#cleanUpAltLocs) + // Thus we have to remove duplicates here by using the atom id + Map uniqueAtomSites = new LinkedHashMap<>(); int groupsize = g.size(); for ( int atompos = 0 ; atompos < groupsize; atompos++) { - Atom a = null ; - - a = g.getAtom(atompos); + Atom a = g.getAtom(atompos); if ( a == null) continue ; - list.add(convertAtomToAtomSite(a, model, chainId, internalChainId)); - + uniqueAtomSites.put(a.getPDBserial(), convertAtomToAtomSite(a, model, chainId, internalChainId)); } + if ( g.hasAltLoc()){ for (Group alt : g.getAltLocs() ) { - list.addAll(convertGroupToAtomSites(alt, model, chainId, internalChainId)); + for (AtomSite atomSite : convertGroupToAtomSites(alt, model, chainId, internalChainId)) { + uniqueAtomSites.put(Integer.parseInt(atomSite.getId()), atomSite); + } } } - return list; + return new ArrayList<>(uniqueAtomSites.values()); } /** diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java index 70cca55f83..3ce4bde692 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java @@ -767,7 +767,6 @@ public void documentEnd() { // Now make sure all altlocgroups have all the atoms in all the groups StructureTools.cleanUpAltLocs(structure); - // NOTE bonds and charges can only be done at this point that the chain id mapping is properly sorted out if (!params.isHeaderOnly()) { if ( params.shouldCreateAtomBonds()) { diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java index 8b55e9f099..817b77535b 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java @@ -652,7 +652,9 @@ public void testMmcifWritingPartialAltlocs() throws IOException { assertEquals(1, c.getAtomGroups().size()); Group g = c.getAtomGroup(0); assertEquals(11, g.size()); - assertEquals(1, g.getAltLocs().size()); + + // there's the main group (. and A) plus the 2 alt loc groups (A and B). The alt locs will contain all the '.' atoms too + assertEquals(2, g.getAltLocs().size()); for (Atom a : g.getAtoms()) { if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB")) @@ -663,6 +665,14 @@ public void testMmcifWritingPartialAltlocs() throws IOException { assertEquals(11, g.getAltLocs().get(0).size()); for (Atom a : g.getAltLocs().get(0).getAtoms()) { + if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB")) + assertEquals(' ', a.getAltLoc().charValue()); + else + assertEquals('A', a.getAltLoc().charValue()); + } + + assertEquals(11, g.getAltLocs().get(1).size()); + for (Atom a : g.getAltLocs().get(1).getAtoms()) { if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB")) assertEquals(' ', a.getAltLoc().charValue()); else From 1d4d597cf8c8961c122211cd0a556995d60c00ec Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Mon, 25 Jun 2018 10:29:47 -0700 Subject: [PATCH 19/37] Docs --- .../org/biojava/nbio/structure/Chain.java | 2 +- .../structure/io/mmcif/MMCIFFileTools.java | 57 ++++++++++--------- 2 files changed, 31 insertions(+), 28 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java index 643007df47..9b350cb60e 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java @@ -281,7 +281,7 @@ public interface Chain extends Serializable { /** * Returns the sequence of amino acids as it has been provided in the ATOM records. * Non-standard residues will be present in the string only if the property - * {@value org.biojava.nbio.structure.io.PDBFileReader.LOAD_CHEM_COMP_PROPERTY} has been set. + * {@value org.biojava.nbio.structure.io.PDBFileReader#LOAD_CHEM_COMP_PROPERTY} has been set. * @return amino acid sequence as string * @see #getSeqResSequence() */ diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java index 8e29983eb2..6216f9d945 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java @@ -334,25 +334,25 @@ public static Cell convertCrystalCellToCell(CrystalCell c) { /** * Converts an Atom object to an {@link AtomSite} object. * @param a - * @param model - * @param chainId - * @param internalChainId + * @param model the model number for the output AtomSites + * @param chainName the chain identifier (author id) for the output AtomSites + * @param chainId the internal chain identifier (asym id) for the output AtomSites * @return */ - public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainId, String internalChainId) { - return convertAtomToAtomSite(a, model, chainId, internalChainId, a.getPDBserial()); + public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainName, String chainId) { + return convertAtomToAtomSite(a, model, chainName, chainId, a.getPDBserial()); } /** * Converts an Atom object to an {@link AtomSite} object. - * @param a - * @param model - * @param chainId - * @param internalChainId + * @param a the atom + * @param model the model number for the output AtomSites + * @param chainName the chain identifier (author id) for the output AtomSites + * @param chainId the internal chain identifier (asym id) for the output AtomSites * @param atomId the atom id to be written to AtomSite * @return */ - public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainId, String internalChainId, int atomId) { + public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainName, String chainId, int atomId) { /* ATOM 7 C CD . GLU A 1 24 ? -10.109 15.374 38.853 1.00 50.05 ? ? ? ? ? ? 24 GLU A CD 1 @@ -404,7 +404,7 @@ record = "ATOM"; atomSite.setLabel_atom_id(a.getName()); atomSite.setLabel_alt_id(altLocStr); atomSite.setLabel_comp_id(g.getPDBName()); - atomSite.setLabel_asym_id(internalChainId); + atomSite.setLabel_asym_id(chainId); atomSite.setLabel_entity_id(entityId); atomSite.setLabel_seq_id(labelSeqId); atomSite.setPdbx_PDB_ins_code(insCode); @@ -415,7 +415,7 @@ record = "ATOM"; atomSite.setB_iso_or_equiv(FileConvert.d2.format(a.getTempFactor())); atomSite.setAuth_seq_id(Integer.toString(g.getResidueNumber().getSeqNum())); atomSite.setAuth_comp_id(g.getPDBName()); - atomSite.setAuth_asym_id(chainId); + atomSite.setAuth_asym_id(chainName); atomSite.setAuth_atom_id(a.getName()); atomSite.setPdbx_PDB_model_num(Integer.toString(model)); @@ -423,18 +423,21 @@ record = "ATOM"; } /** - * Converts a Group into a List of {@link AtomSite} objects - * @param g - * @param model - * @param chainId - * @param internalChainId + * Converts a Group into a List of {@link AtomSite} objects. + * Atoms in other altloc groups (different from the main group) are also included, removing possible duplicates + * via using the atom identifier to assess uniqueness. + * @param g the group + * @param model the model number for the output AtomSites + * @param chainName the chain identifier (author id) for the output AtomSites + * @param chainId the internal chain identifier (asym id) for the output AtomSites * @return */ - private static List convertGroupToAtomSites(Group g, int model, String chainId, String internalChainId) { + public static List convertGroupToAtomSites(Group g, int model, String chainName, String chainId) { // The alt locs can have duplicates, since at parsing time we make sure that all alt loc groups have // all atoms (see StructureTools#cleanUpAltLocs) // Thus we have to remove duplicates here by using the atom id + // See issue https://github.com/biojava/biojava/issues/778 and TestAltLocs.testMmcifWritingAllAltlocs/testMmcifWritingPartialAltlocs Map uniqueAtomSites = new LinkedHashMap<>(); int groupsize = g.size(); @@ -444,12 +447,12 @@ private static List convertGroupToAtomSites(Group g, int model, String if ( a == null) continue ; - uniqueAtomSites.put(a.getPDBserial(), convertAtomToAtomSite(a, model, chainId, internalChainId)); + uniqueAtomSites.put(a.getPDBserial(), convertAtomToAtomSite(a, model, chainName, chainId)); } if ( g.hasAltLoc()){ for (Group alt : g.getAltLocs() ) { - for (AtomSite atomSite : convertGroupToAtomSites(alt, model, chainId, internalChainId)) { + for (AtomSite atomSite : convertGroupToAtomSites(alt, model, chainName, chainId)) { uniqueAtomSites.put(Integer.parseInt(atomSite.getId()), atomSite); } } @@ -459,15 +462,15 @@ private static List convertGroupToAtomSites(Group g, int model, String /** * Converts a Chain into a List of {@link AtomSite} objects - * @param c - * @param model - * @param authorId - * @param asymId + * @param c the chain + * @param model the model number for the output AtomSites + * @param chainName the chain identifier (author id) for the output AtomSites + * @param chainId the internal chain identifier (asym id) for the output AtomSites * @return */ - public static List convertChainToAtomSites(Chain c, int model, String authorId, String asymId) { + public static List convertChainToAtomSites(Chain c, int model, String chainName, String chainId) { - List list = new ArrayList(); + List list = new ArrayList<>(); if (c.getEntityInfo()==null) { logger.warn("No Compound (entity) found for chain {}: entity_id will be set to 0, label_seq_id will be the same as auth_seq_id", c.getName()); @@ -477,7 +480,7 @@ public static List convertChainToAtomSites(Chain c, int model, String Group g= c.getAtomGroup(h); - list.addAll(convertGroupToAtomSites(g, model, authorId, asymId)); + list.addAll(convertGroupToAtomSites(g, model, chainName, chainId)); } From 7a36714aa966c9e26e1598cad1974912a108ad6f Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Mon, 2 Jul 2018 09:57:03 -0700 Subject: [PATCH 20/37] Uniprot has switched to https --- .../nbio/core/sequence/loader/UniprotProxySequenceReader.java | 4 +++- .../org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java | 3 ++- 2 files changed, 5 insertions(+), 2 deletions(-) diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java index 4ce8c0d3ba..06cfd283f9 100644 --- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java +++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java @@ -76,7 +76,9 @@ public class UniprotProxySequenceReader implements ProxySequ private static final String TREMBLID_PATTERN = "[A-NR-Z][0-9]([A-Z][A-Z0-9]{2}[0-9]){1,2}"; public static final Pattern UP_AC_PATTERN = Pattern.compile("(" + SPID_PATTERN + "|" + TREMBLID_PATTERN + ")"); - private static String uniprotbaseURL = "http://www.uniprot.org"; //"http://pir.uniprot.org"; + public static final String DEFAULT_UNIPROT_BASE_URL = "https://www.uniprot.org"; + + private static String uniprotbaseURL = DEFAULT_UNIPROT_BASE_URL; private static String uniprotDirectoryCache = null; private String sequence; private CompoundSet compoundSet; diff --git a/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java b/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java index c6ade3dfef..d3c50fd61b 100644 --- a/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java +++ b/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java @@ -84,7 +84,8 @@ private void testUniprot(String uniprotID) throws CompoundNotFoundException, IOE } - /** Fetch a protein sequence from the UniProt web site + /** + * Fetch a protein sequence from the UniProt web site * * @param uniProtID * @return a Protein Sequence From 2b66631970fe352be0827516f7542ac9199bc3ac Mon Sep 17 00:00:00 2001 From: Spencer Bliven Date: Wed, 11 Jul 2018 16:49:57 +0200 Subject: [PATCH 21/37] Switch ftp.ebi.ac.uk URLs to use HTTP. Travis blocks FTP so we're avoiding it. --- .../java/org/biojava/nbio/structure/io/LocalPDBDirectory.java | 2 +- .../nbio/structure/io/sifts/SiftsChainToUniprotMapping.java | 2 +- .../biojava/nbio/structure/io/sifts/SiftsMappingProvider.java | 2 +- .../main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java | 2 +- 4 files changed, 4 insertions(+), 4 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java index 80ea228b05..d4f6c7222a 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java @@ -688,7 +688,7 @@ public static String getServerName() { name = DEFAULT_PDB_FILE_SERVER; logger.debug("Using default PDB file server {}",name); } else { - if (!name.startsWith("http://") && !name.startsWith("ftp://")) { + if (!name.startsWith("http://") && !name.startsWith("ftp://") && !name.startsWith("https://")) { logger.warn("Server name {} read from system property {} does not have a leading protocol string. Adding http:// to it", name, PDB_FILE_SERVER_PROPERTY); name = "http://"+name; } diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java index e47b112a6b..84cd9ae138 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java @@ -66,7 +66,7 @@ public class SiftsChainToUniprotMapping { static { try { - DEFAULT_URL = new URL("ftp://ftp.ebi.ac.uk/pub/databases/msd/sifts/flatfiles/tsv/pdb_chain_uniprot.tsv.gz"); + DEFAULT_URL = new URL("http://ftp.ebi.ac.uk/pub/databases/msd/sifts/flatfiles/tsv/pdb_chain_uniprot.tsv.gz"); } catch (MalformedURLException e) { throw new RuntimeException(e); } diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java index 7340be1ee5..7c67305f3c 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java @@ -41,7 +41,7 @@ public class SiftsMappingProvider { private final static Logger logger = LoggerFactory.getLogger(SiftsMappingProvider.class); - private static final String EBI_SIFTS_FILE_LOCATION = "ftp://ftp.ebi.ac.uk/pub/databases/msd/sifts/xml/%s.xml.gz"; + private static final String EBI_SIFTS_FILE_LOCATION = "http://ftp.ebi.ac.uk/pub/databases/msd/sifts/xml/%s.xml.gz"; private static String fileLoc = EBI_SIFTS_FILE_LOCATION; diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java index 25b6e25b8c..b4860b2cf1 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java @@ -33,7 +33,7 @@ public class RCSBUpdates { // The URL for acquiring the data - public static final String baseURL = "ftp://ftp.rcsb.org/pub/pdb/data/status/latest/"; + public static final String baseURL = "http://ftp.rcsb.org/pub/pdb/data/status/latest/"; /** * From 00fa75128d5b55518c787e6800eb93cc5dfcf879 Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Fri, 13 Jul 2018 12:26:01 -0700 Subject: [PATCH 22/37] Implementing @sbliven suggestions --- .../src/main/java/org/biojava/nbio/structure/Group.java | 4 ++-- .../src/test/java/org/biojava/nbio/structure/TestAltLocs.java | 4 ++-- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java index 19d4007863..39efab13ae 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java @@ -354,8 +354,8 @@ public interface Group extends Serializable { * * *

    - * Note that all groups (main and altlocs) will contain all atoms, thus atoms from the default group - * can appear duplicated in main and altloc groups. + * Note that atoms with the default altloc (.) are included in all groups. Atoms with other altlocs (typically A, B, etc) + * will be sorted into groups by altloc. *

    * Thus it can happen that an altloc group duplicate the contents of the main group. * diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java index 817b77535b..5a66cdcae0 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java @@ -596,7 +596,7 @@ public void test3U7Tmmcif() throws IOException, StructureException{ } @Test - public void testMmcifWritingPartialAltlocs() throws IOException { + public void testMmcifConversionPartialAltlocs() throws IOException { String mmcifData = "data_test\n" + "loop_\n" + @@ -685,7 +685,7 @@ public void testMmcifWritingPartialAltlocs() throws IOException { } @Test - public void testMmcifWritingAllAltlocs() throws IOException { + public void testMmcifConversionAllAltlocs() throws IOException { String mmcifData = "data_test\n" + "loop_\n" + From b61262af1b72ca1f8fbbd6e6cc664b78198c68a1 Mon Sep 17 00:00:00 2001 From: Aleix Lafita Date: Thu, 26 Jul 2018 14:06:12 +0100 Subject: [PATCH 23/37] Update Jmol version to 14.29.17 --- biojava-structure-gui/pom.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/biojava-structure-gui/pom.xml b/biojava-structure-gui/pom.xml index 97147f839b..8b96b88dea 100644 --- a/biojava-structure-gui/pom.xml +++ b/biojava-structure-gui/pom.xml @@ -42,7 +42,7 @@ net.sourceforge.jmol jmol - 14.6.2_2016.08.28 + 14.29.17 From 00f25a7abe4db0754c937e9e849b4e23058f562e Mon Sep 17 00:00:00 2001 From: Aleix Lafita Date: Thu, 26 Jul 2018 14:07:41 +0100 Subject: [PATCH 24/37] Revert to mmCIF for Jmol view #629 --- .../structure/align/gui/jmol/JmolPanel.java | 56 ++++++++++++------- 1 file changed, 35 insertions(+), 21 deletions(-) diff --git a/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java b/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java index 232b37d295..2aab5fc80c 100644 --- a/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java +++ b/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java @@ -126,30 +126,44 @@ public JmolStatusListener getStatusListener(){ public void executeCmd(String rasmolScript) { viewer.evalString(rasmolScript); } - - public void setStructure(final Structure s) - { + + public void setStructure(final Structure s, boolean useMmtf) { + this.structure = s; - try ( - PipedOutputStream out = new PipedOutputStream(); - // Viewer requires a BufferedInputStream for reflection - InputStream in = new BufferedInputStream(new PipedInputStream(out)); - ) { - new Thread((Runnable)() -> { - try { - MmtfActions.writeToOutputStream(s,out); - } catch (Exception e) { - logger.error("Error generating MMTF output for {}", - s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e); - } - }).start(); - viewer.openReader(null, in); - } catch (IOException e) { - logger.error("Error transfering {} to Jmol", - s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e); + + if (useMmtf) { + try ( + PipedOutputStream out = new PipedOutputStream(); + // Viewer requires a BufferedInputStream for reflection + InputStream in = new BufferedInputStream(new PipedInputStream(out)); + ) { + new Thread((Runnable)() -> { + try { + MmtfActions.writeToOutputStream(s,out); + } catch (Exception e) { + logger.error("Error generating MMTF output for {}", + s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e); + } + }).start(); + viewer.openReader(null, in); + } catch (IOException e) { + logger.error("Error transfering {} to Jmol", + s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e); + } + } else { + // Use mmCIF format + String serialized = s.toMMCIF(); + viewer.openStringInline(serialized); + } - + evalString("save STATE state_1"); + + } + + public void setStructure(final Structure s) { + // Set the default to MMCIF (until issue #629 is fixed) + setStructure(s, false); } /** assign a custom color to the Jmol chains command. From eadd1efc40c862e6805e97016cd91c727af6d9d2 Mon Sep 17 00:00:00 2001 From: DK-MV Date: Sat, 28 Jul 2018 21:49:34 +0200 Subject: [PATCH 25/37] Made a couple of test platform independent --- .../biojava/nbio/alignment/TestSubOptimalMSA.java | 12 ++++++------ .../org/biojava/nbio/phylo/TestForesterWrapper.java | 8 ++++---- 2 files changed, 10 insertions(+), 10 deletions(-) diff --git a/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java b/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java index 7259f56a27..13a14120a5 100644 --- a/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java +++ b/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java @@ -55,9 +55,9 @@ public void gapPenalty52() { Profile msa = Alignments .getMultipleSequenceAlignment(sequences, gapP); - assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n" - + "TTGGGGCCTCTAAACGGG-TCTT\n" - + "TTGGGGC-TCTAA-CGGG-TCTT\n", + assertEquals("TTGGGGCCTCTAAACGGGGTCTT" + System.lineSeparator() + + "TTGGGGCCTCTAAACGGG-TCTT" + System.lineSeparator() + + "TTGGGGC-TCTAA-CGGG-TCTT" + System.lineSeparator(), msa.toString()); ConcurrencyTools.shutdown(); @@ -71,9 +71,9 @@ public void gapPenaltyDefault() { .getMultipleSequenceAlignment(sequences, gapP); // TODO test not passing (see issue 288 in github) - Aleix 03.2016 - assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n" - + "TTGGGGCCTCTAAACGGG-TCTT\n" - + "TTGGGGC-TCTAA-CGGG-TCTT\n", + assertEquals("TTGGGGCCTCTAAACGGGGTCTT" + System.lineSeparator() + + "TTGGGGCCTCTAAACGGG-TCTT" + System.lineSeparator() + + "TTGGGGC-TCTAA-CGGG-TCTT" + System.lineSeparator(), msa.toString()); ConcurrencyTools.shutdown(); diff --git a/biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java b/biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java index 908ec154bb..c4fe468852 100644 --- a/biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java +++ b/biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java @@ -72,8 +72,8 @@ public void testMSAconversion() throws Exception { String expected = ""; for (ProteinSequence proteinSequence : proteinSequences.values()) { msa.addAlignedSequence(proteinSequence); - expected += ">" + proteinSequence.getOriginalHeader() + "\n" - + proteinSequence.toString() + "\n"; + expected += ">" + proteinSequence.getOriginalHeader() + System.lineSeparator() + + proteinSequence.toString() + System.lineSeparator(); } // Convert the biojava MSA to a FASTA String @@ -95,8 +95,8 @@ public String getHeader(ProteinSequence sequence) { StringBuilder sb = new StringBuilder(); for (int i = 0; i < fMsa.getNumberOfSequences(); i++) { - sb.append(">" + fMsa.getIdentifier(i) + "\n"); - sb.append(fMsa.getSequenceAsString(i) + "\n"); + sb.append(">" + fMsa.getIdentifier(i) + System.lineSeparator()); + sb.append(fMsa.getSequenceAsString(i) + System.lineSeparator()); } String forester = sb.toString(); From 622c38f93181c532c6925b270d2b8fdf6786e10b Mon Sep 17 00:00:00 2001 From: DK-MV Date: Sat, 28 Jul 2018 21:50:49 +0200 Subject: [PATCH 26/37] Implemented bond-cloning in group-elements --- .../biojava/nbio/structure/AminoAcidImpl.java | 16 +++ .../biojava/nbio/structure/HetatomImpl.java | 16 ++- .../nbio/structure/NucleotideImpl.java | 18 ++- .../biojava/nbio/structure/TestCloning.java | 104 +++++++++--------- 4 files changed, 103 insertions(+), 51 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java index 057a0e7497..40513d9a04 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java @@ -23,6 +23,8 @@ */ package org.biojava.nbio.structure; +import java.util.List; + /** * AminoAcid inherits most from Hetatom. Adds a few AminoAcid * specific methods. @@ -173,6 +175,20 @@ public Object clone() { n.addAtom(atom); atom.setGroup(n); } + //copy the bonds. + for (int i=0;i bonds1 = atom1.getBonds(); + if (bonds1 != null) { + for (Bond b : bonds1) { + int atomAIndex = atoms.indexOf(b.getAtomA()); + int atomBIndex = atoms.indexOf(b.getAtomB()); + // The order of the atoms are the same on the original and the cloned object, which we use here. + Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); + n.getAtom(i).addBond(newBond); + } + } + } // copying the alt loc groups if present, otherwise they stay null if (getAltLocs()!=null && !getAltLocs().isEmpty()) { diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java index 3181f659e5..286fd15330 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java @@ -459,7 +459,21 @@ public Object clone() { n.addAtom(atom); atom.setGroup(n); } - + //copy the bonds. + for (int i=0;i bonds1 = atom1.getBonds(); + if (bonds1 != null) { + for (Bond b : bonds1) { + int atomAIndex = atoms.indexOf(b.getAtomA()); + int atomBIndex = atoms.indexOf(b.getAtomB()); + // The order of the atoms are the same on the original and the cloned object, which we use here. + Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); + n.getAtom(i).addBond(newBond); + } + } + } + // copying the alt loc groups if present, otherwise they stay null if (altLocs!=null) { for (Group altLocGroup:this.altLocs) { diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java index d3660794a1..450591d7fd 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java @@ -23,6 +23,8 @@ */ package org.biojava.nbio.structure; +import java.util.List; + /** * A nucleotide group is almost the same as a Hetatm group. * @see HetatomImpl @@ -107,7 +109,21 @@ public Object clone() { n.addAtom(atom); atom.setGroup(n); } - + //copy the bonds. + for (int i=0;i bonds1 = atom1.getBonds(); + if (bonds1 != null) { + for (Bond b : bonds1) { + int atomAIndex = atoms.indexOf(b.getAtomA()); + int atomBIndex = atoms.indexOf(b.getAtomB()); + // The order of the atoms are the same on the original and the cloned object, which we use here. + Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); + n.getAtom(i).addBond(newBond); + } + } + } + // copying the alt loc groups if present, otherwise they stay null if (getAltLocs()!=null && !getAltLocs().isEmpty()) { for (Group altLocGroup:this.getAltLocs()) { diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java index 233f7c1cb8..7c76547810 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java @@ -24,6 +24,9 @@ */ package org.biojava.nbio.structure; +import static org.junit.Assert.assertEquals; +import static org.junit.Assert.assertNotEquals; +import static org.junit.Assert.assertNotNull; import java.io.IOException; import java.util.Iterator; @@ -32,7 +35,6 @@ import org.biojava.nbio.structure.align.util.AtomCache; import org.biojava.nbio.structure.io.FileParsingParameters; import org.junit.Test; -import static org.junit.Assert.*; public class TestCloning { @@ -41,8 +43,8 @@ public void test1a4wCloning() throws StructureException, IOException { Structure s; - AtomCache cache = new AtomCache(); - FileParsingParameters params = new FileParsingParameters(); + final AtomCache cache = new AtomCache(); + final FileParsingParameters params = new FileParsingParameters(); params.setAlignSeqRes(true); cache.setFileParsingParams(params); @@ -50,22 +52,19 @@ public void test1a4wCloning() throws StructureException, IOException { s = StructureIO.getStructure("1a4w"); - Structure c = s.clone(); + final Structure c = s.clone(); - compareCloned(s,c); + compareCloned(s, c); } - - @Test public void testAsymUnitCloning() throws StructureException, IOException { Structure s; - - AtomCache cache = new AtomCache(); - FileParsingParameters params = new FileParsingParameters(); + final AtomCache cache = new AtomCache(); + final FileParsingParameters params = new FileParsingParameters(); params.setAlignSeqRes(false); cache.setFileParsingParams(params); @@ -73,98 +72,105 @@ public void testAsymUnitCloning() throws StructureException, IOException { s = StructureIO.getStructure("1stp"); - Structure c = s.clone(); + final Structure c = s.clone(); - compareCloned(s,c); + compareCloned(s, c); } @Test public void testBioUnitCloning() throws StructureException, IOException { Structure s; - s = StructureIO.getBiologicalAssembly("1stp",1); + s = StructureIO.getBiologicalAssembly("1stp", 1); - Structure c = s.clone(); + final Structure c = s.clone(); - compareCloned(s,c); + compareCloned(s, c); } /** * A Structure with alt locs, we make sure they are being cloned too + * * @throws StructureException * @throws IOException */ @Test public void test3piuCloning() throws StructureException, IOException { - AtomCache cache = new AtomCache(); - FileParsingParameters params = new FileParsingParameters(); + final AtomCache cache = new AtomCache(); + final FileParsingParameters params = new FileParsingParameters(); params.setAlignSeqRes(true); cache.setFileParsingParams(params); StructureIO.setAtomCache(cache); - Structure s = StructureIO.getStructure("3piu"); + final Structure s = StructureIO.getStructure("3piu"); - Structure c = s.clone(); + final Structure c = s.clone(); compareCloned(s, c); } - private void compareCloned(Structure s, Structure c) throws StructureException { + private void compareCloned(final Structure s, final Structure c) throws StructureException { assertEquals(s.getChains().size(), c.getChains().size()); - for ( Chain chain : s.getChains()) { + for (final Chain chain : s.getChains()) { - Chain test = c.getChain(chain.getId()); + final Chain test = c.getChain(chain.getId()); - assertEquals("Could not correctly clone seqres for chain " + chain.getId() , chain.getSeqResLength(),test.getSeqResLength()); + assertEquals("Could not correctly clone seqres for chain " + chain.getId(), chain.getSeqResLength(), + test.getSeqResLength()); - assertEquals("Could not correctly clone atom records for chain " + chain.getId() , chain.getAtomLength(),test.getAtomLength()); + assertEquals("Could not correctly clone atom records for chain " + chain.getId(), chain.getAtomLength(), + test.getAtomLength()); Iterator it = test.getAtomGroups().iterator(); - for (Group g : chain.getAtomGroups()) { - Group testGroup = it.next(); - //if (g.hasAltLoc()) { - // System.out.println(g.toString()); - //} + for (final Group g : chain.getAtomGroups()) { + final Group testGroup = it.next(); + // if (g.hasAltLoc()) { + // System.out.println(g.toString()); + // } assertEquals(g.getAltLocs().size(), testGroup.getAltLocs().size()); } - + it = test.getSeqResGroups().iterator(); - for (Group g: chain.getSeqResGroups()) { - Group testGroup = it.next(); + for (final Group g : chain.getSeqResGroups()) { + final Group testGroup = it.next(); assertEquals(g.getAltLocs().size(), testGroup.getAltLocs().size()); } } - Atom[] allAtoms = StructureTools.getAllAtomArray(s); + final Atom[] allAtoms = StructureTools.getAllAtomArray(s); - Atom[] allAtomsCloned = StructureTools.getAllAtomArray(c); + final Atom[] allAtomsCloned = StructureTools.getAllAtomArray(c); - assertEquals(allAtoms.length,allAtomsCloned.length); + assertEquals(allAtoms.length, allAtomsCloned.length); } - + @Test - public void testBondCloning() throws IOException, StructureException { + public void testBondCloning() throws IOException, StructureException { - AtomCache cache = new AtomCache(); - cache.setUseMmCif(true); + final AtomCache cache = new AtomCache(); + cache.setUseMmCif(true); - FileParsingParameters params = cache.getFileParsingParams(); - params.setCreateAtomBonds(true); - cache.setFileParsingParams(params); + final FileParsingParameters params = cache.getFileParsingParams(); + params.setCreateAtomBonds(true); + cache.setFileParsingParams(params); - Structure s = cache.getStructure("2I13"); - List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); - assertNotNull(bonds); + final Structure s = cache.getStructure("2I13"); + final List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds); - Structure s2 = s.clone(); - bonds = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); - assertNotNull(bonds); - } + final Structure s2 = s.clone(); + final List bonds2 = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds2); + + assertEquals(bonds.toString(), bonds2.toString()); + // But the objects should be different as the atoms are clones + assertNotEquals(bonds.toArray(), bonds2.toArray()); + } } From 0a6972ea49b998b6d509b8f7f0614cdcf9d06671 Mon Sep 17 00:00:00 2001 From: DK-MV Date: Sun, 29 Jul 2018 18:16:26 +0200 Subject: [PATCH 27/37] Code Refactoring to minimize dublicate code --- .../biojava/nbio/structure/AminoAcidImpl.java | 26 ++---------- .../biojava/nbio/structure/HetatomImpl.java | 42 +++++++++++-------- .../nbio/structure/NucleotideImpl.java | 24 +---------- .../biojava/nbio/structure/TestCloning.java | 16 +++++-- 4 files changed, 41 insertions(+), 67 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java index 40513d9a04..bb7d1091e7 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java @@ -23,8 +23,6 @@ */ package org.biojava.nbio.structure; -import java.util.List; - /** * AminoAcid inherits most from Hetatom. Adds a few AminoAcid * specific methods. @@ -169,27 +167,9 @@ public Object clone() { n.setAminoType(getAminoType()); n.setRecordType(recordType); - // copy the atoms - for (Atom atom1 : atoms) { - Atom atom = (Atom) atom1.clone(); - n.addAtom(atom); - atom.setGroup(n); - } - //copy the bonds. - for (int i=0;i bonds1 = atom1.getBonds(); - if (bonds1 != null) { - for (Bond b : bonds1) { - int atomAIndex = atoms.indexOf(b.getAtomA()); - int atomBIndex = atoms.indexOf(b.getAtomB()); - // The order of the atoms are the same on the original and the cloned object, which we use here. - Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); - n.getAtom(i).addBond(newBond); - } - } - } - + //clone atoms and bonds. + cloneAtomsAndBonds(n); + // copying the alt loc groups if present, otherwise they stay null if (getAltLocs()!=null && !getAltLocs().isEmpty()) { for (Group altLocGroup:this.getAltLocs()) { diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java index 286fd15330..d767d37daf 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java @@ -453,13 +453,32 @@ public Object clone() { n.setPDBName(getPDBName()); + //clone atoms and bonds. + cloneAtomsAndBonds(n); + + // copying the alt loc groups if present, otherwise they stay null + if (altLocs!=null) { + for (Group altLocGroup:this.altLocs) { + Group nAltLocGroup = (Group)altLocGroup.clone(); + n.addAltLoc(nAltLocGroup); + } + } + + if (chemComp!=null) + n.setChemComp(chemComp); + + return n; + } + + + protected void cloneAtomsAndBonds(Group newGroup) { // copy the atoms for (Atom atom1 : atoms) { Atom atom = (Atom) atom1.clone(); - n.addAtom(atom); - atom.setGroup(n); + newGroup.addAtom(atom); + atom.setGroup(newGroup); } - //copy the bonds. + // copy the bonds for (int i=0;i bonds1 = atom1.getBonds(); @@ -468,24 +487,11 @@ public Object clone() { int atomAIndex = atoms.indexOf(b.getAtomA()); int atomBIndex = atoms.indexOf(b.getAtomB()); // The order of the atoms are the same on the original and the cloned object, which we use here. - Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); - n.getAtom(i).addBond(newBond); + Bond newBond = new BondImpl(newGroup.getAtom(atomAIndex), newGroup.getAtom(atomBIndex), b.getBondOrder(), false); + newGroup.getAtom(i).addBond(newBond); } } } - - // copying the alt loc groups if present, otherwise they stay null - if (altLocs!=null) { - for (Group altLocGroup:this.altLocs) { - Group nAltLocGroup = (Group)altLocGroup.clone(); - n.addAltLoc(nAltLocGroup); - } - } - - if (chemComp!=null) - n.setChemComp(chemComp); - - return n; } /** the Hibernate database ID diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java index 450591d7fd..b12e0ce453 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java @@ -23,8 +23,6 @@ */ package org.biojava.nbio.structure; -import java.util.List; - /** * A nucleotide group is almost the same as a Hetatm group. * @see HetatomImpl @@ -103,26 +101,8 @@ public Object clone() { n.setPDBName(getPDBName()); - // copy the atoms - for (Atom atom1 : atoms) { - Atom atom = (Atom) atom1.clone(); - n.addAtom(atom); - atom.setGroup(n); - } - //copy the bonds. - for (int i=0;i bonds1 = atom1.getBonds(); - if (bonds1 != null) { - for (Bond b : bonds1) { - int atomAIndex = atoms.indexOf(b.getAtomA()); - int atomBIndex = atoms.indexOf(b.getAtomB()); - // The order of the atoms are the same on the original and the cloned object, which we use here. - Bond newBond = new BondImpl(n.getAtom(atomAIndex), n.getAtom(atomBIndex), b.getBondOrder(), false); - n.getAtom(i).addBond(newBond); - } - } - } + //clone atoms and bonds. + cloneAtomsAndBonds(n); // copying the alt loc groups if present, otherwise they stay null if (getAltLocs()!=null && !getAltLocs().isEmpty()) { diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java index 7c76547810..0f60220a79 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java @@ -91,7 +91,7 @@ public void testBioUnitCloning() throws StructureException, IOException { /** * A Structure with alt locs, we make sure they are being cloned too - * + * * @throws StructureException * @throws IOException */ @@ -161,16 +161,24 @@ public void testBondCloning() throws IOException, StructureException { cache.setFileParsingParams(params); final Structure s = cache.getStructure("2I13"); - final List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); assertNotNull(bonds); - final Structure s2 = s.clone(); - final List bonds2 = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); + Structure s2 = s.clone(); + List bonds2 = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds(); assertNotNull(bonds2); assertEquals(bonds.toString(), bonds2.toString()); // But the objects should be different as the atoms are clones assertNotEquals(bonds.toArray(), bonds2.toArray()); + + // Also test for polymeric chains + bonds = s.getPolyChain("E").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds); + + s2 = s.clone(); + bonds2 = s2.getPolyChain("E").getAtomGroup(0).getAtom(0).getBonds(); + assertNotNull(bonds2); } } From 1a8c10068348b34def6dd5d0ab52a43385bea1f4 Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Mon, 6 Aug 2018 17:12:51 -0700 Subject: [PATCH 28/37] Extending back the changelog by taking it from old wiki doc --- CHANGELOG.md | 95 ++++++++++++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 95 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 7847c65aaa..f5d82a24c6 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -239,3 +239,98 @@ BioJava 4.2.0 offers many new features, as well several bug-fixes. - provide methods for common distance matrix calculations and framework for user-defined distances - update the forester version to have the correct NJ tree constructor - correct some of the tree evaluator statistics. + +BioJava 4.1.0 +============= + +release date: June 24th 2015 + +### New Features: + +- New algorithm for multiple structure alignments +- Improved visualization of structural alignments in Jmol +- Support for the ECOD protein classification +- Better mmCIF support: limited write support, better parsing + +BioJava 4.0.0 +============= + +release date: January 30th 2015 + +### New Features: + +- General + - Consistent error logging. SLF4J is used for logging and provides adaptors for all major + logging implementations. (many contributors, including @benjamintboyle and @josemduarte) + - Improved handling of exceptions (@dmyersturnbull) + - Removed deprecated methods + - Expanded the BioJava tutorial (@andreasprlic, @josemduarte, and @sbliven) + - Updated dependencies where applicable + - Available on Maven Central (@andreasprlic and @heuermh) +- biojava3-core + - Improved Genbank parser, including support for feature records, qualifiers, and nested + locations. (@paolopavan and @jgrzebyta) +- biojava3-structure + - Better support for crystallographic information, including crystallographic operators, + unit cells, and protein-protein interfaces. (@josemduarte) + - Better organization of downloaded structure files (set using the PDB_DIR and PDB_CACHE_DIR + environmental variables) (@sbliven) + - Better command-line tools for structure alignment (@sbliven) + - New algorithm for symmetry detection in biological assemblies (@pwrose) + - New algorithm for fast contact calculation, both intra-chain and inter-chain (@josemduarte) + - Support for Accessible Surface Area (ASA) calculation through and implementation of + the Shrake & Rupley algorithm, both single-thread and parallel (memory permitting) (@josemduarte) + - Support for large structures (memory permitting) and multi-character chain IDs. + - Default to mmCIF file format, as recommended by the wwPDB + +This version is compatible with Java 6, 7, and 8. + +### Upgrading +Since we renamed all package names to be consistent across the whole project, +there will be import errors when upgrading to this version. These can automatically get resolved +by IDEs such as Eclipse or IntelliJ by selecting the Optimize Import menu item. + +BioJava 3.1.0 +============= + +release date: August 25th 2014 + +While most development is going towards the upcoming 4.0.0 release, this release provides +bug fixes and a few new features: + +- CE-CP version 1.4, with additional parameters +- Update to SCOPe 2.04 +- Improvements in FASTQ parsing +- Fix bugs in PDB parsing +- Minor fixes in structure alignments + +This version is compatible with Java 6 and 7. + +BioJava 3.0.8 +============= + +release date: March 25th 2014 + +New Features: + +- New Genbank writer +- New parser for Karyotype file from UCSC +- New parser for Gene locations from UCSC +- New parser for Gene names file from genenames.org +- New module for Cox regression code for survival analysis +- New calculation of accessible surface area (ASA) +- New module for parsing .OBO files (ontologies) +- Improved representation of SCOP and Berkeley-SCOP classifications + +BioJava 3.0.7 +============= + +release date: September 23rd 2013 + +New features: + +- added a basic genbank parser +- fixed a problem when translating codons with N +- now can infer bonds in protein structures +- added support to parse mmcif records for organism and expression system +- many small bug fixes and improvements From a6012cdc708e61dad9d3e04752683ae9a432b0b1 Mon Sep 17 00:00:00 2001 From: Dmytro Guzenko Date: Thu, 16 Aug 2018 16:04:46 -0700 Subject: [PATCH 29/37] Logger string formatting changed to brackets (faster execution). --- .../nbio/structure/secstruc/SecStrucCalc.java | 41 ++++++++----------- 1 file changed, 18 insertions(+), 23 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java index 3a125fe078..8e623c24f6 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java @@ -230,7 +230,7 @@ private void createLadders(){ private void updateSheets() { - logger.debug(" got " +ladders.size() + " ladders!"); + logger.debug(" got {} ladders!", ladders.size()); for (Ladder ladder : ladders){ logger.debug(ladder.toString()); @@ -308,7 +308,7 @@ private void connectLadders() { if (hasBulge(l1,l2)) { l1.connectedTo = j; l2.connectedFrom = i; - logger.debug("Bulge from " + i + " to " + j); + logger.debug("Bulge from {} to {}", i, j); } } } @@ -362,8 +362,7 @@ private void registerBridge(int i, int j, BridgeType btype) { boolean b2 = getSecStrucState(j).addBridge(bridge); if (!b1 && !b2) - logger.warn("Ignoring Bridge between residues" + i + " and " + j - + ". DSSP assignment might differ."); + logger.warn("Ignoring Bridge between residues {} and {}. DSSP assignment might differ.", i, j); bridges.add(bridge); } @@ -799,11 +798,11 @@ private void checkAddHBond(int i, int j){ SecStrucGroup one = groups[i]; if (one.getPDBName().equals("PRO")){ - logger.debug("Ignore: PRO " + one.getResidueNumber()); + logger.debug("Ignore: PRO {}", one.getResidueNumber()); return; } if (!one.hasAtom("H")) { - logger.debug("Residue "+one.getResidueNumber()+" has no H"); + logger.debug("Residue {} has no H",one.getResidueNumber()); return; } @@ -817,7 +816,7 @@ private void checkAddHBond(int i, int j){ logger.warn("Energy calculation failed", e); return; } - logger.debug("Energy between positions ("+i+","+j+"): "+energy); + logger.debug("Energy between positions ({},{}): ",i,j,energy); trackHBondEnergy(i,j,energy); } @@ -848,12 +847,9 @@ private static double calculateHBondEnergy(SecStrucGroup one, double dho = Calc.getDistance(O,H); double dnc = Calc.getDistance(C,N); - logger.debug(" cccc: " + one.getResidueNumber() + - " " + one.getPDBName() + " " +two.getResidueNumber()+ - " " + two.getPDBName() + String.format(" O ("+ - O.getPDBserial()+")..N ("+ N.getPDBserial()+ - "):%4.1f | ho:%4.1f - hc:%4.1f + nc:%4.1f - no:%4.1f ", - dno,dho,dhc,dnc,dno)); + logger.debug(" cccc: {} {} {} {} O ({})..N ({}):{} | ho:{} - hc:{} + nc:{} - no:{}", + one.getResidueNumber(),one.getPDBName(),two.getResidueNumber(),two.getPDBName(), + O.getPDBserial(),N.getPDBserial(),dno,dho,dhc,dnc,dno); //there seems to be a contact! if ( (dno < MINDIST) || (dhc < MINDIST) || @@ -866,8 +862,7 @@ private static double calculateHBondEnergy(SecStrucGroup one, double energy = e1 + e2; - logger.debug(String.format(" N (%d) O(%d): %4.1f : %4.2f ", - N.getPDBserial(),O.getPDBserial(), (float) dno, energy)); + logger.debug(" N ({}) O({}): {} : {} ",N.getPDBserial(),O.getPDBserial(),(float) dno,energy); //Avoid too strong energy if (energy > HBONDLOWENERGY) return energy; @@ -882,7 +877,7 @@ private static double calculateHBondEnergy(SecStrucGroup one, private void trackHBondEnergy(int i, int j, double energy) { if (groups[i].getPDBName().equals("PRO")) { - logger.debug("Ignore: PRO " + groups[i].getResidueNumber()); + logger.debug("Ignore: PRO {}",groups[i].getResidueNumber()); return; } @@ -897,7 +892,7 @@ private void trackHBondEnergy(int i, int j, double energy) { //Acceptor: N-H-->O if (energy < acc1e) { - logger.debug(energy +"<"+acc1e); + logger.debug("{} < {}",energy,acc1e); stateOne.setAccept2(stateOne.getAccept1()); HBond bond = new HBond(); @@ -907,7 +902,7 @@ private void trackHBondEnergy(int i, int j, double energy) { stateOne.setAccept1(bond); } else if ( energy < acc2e ) { - logger.debug(energy +"<"+acc2e); + logger.debug("{} < {}",energy,acc2e); HBond bond = new HBond(); bond.setEnergy(energy); @@ -919,7 +914,7 @@ private void trackHBondEnergy(int i, int j, double energy) { //The other side of the bond: donor O-->N-H if (energy < don1e) { - logger.debug(energy +"<"+don1e); + logger.debug("{} < {}",energy,don1e); stateTwo.setDonor2(stateTwo.getDonor1()); HBond bond = new HBond(); @@ -929,7 +924,7 @@ private void trackHBondEnergy(int i, int j, double energy) { stateTwo.setDonor1(bond); } else if ( energy < don2e ) { - logger.debug(energy +"<"+don2e); + logger.debug("{} < {}",energy,don2e); HBond bond = new HBond(); bond.setEnergy(energy); @@ -951,7 +946,7 @@ private void calculateTurns(){ //Check for H bond from NH(i+n) to CO(i) if (isBonded(i, i+turn)) { - logger.debug("Turn at ("+i+","+(i+turn)+") turn "+turn); + logger.debug("Turn at ({},{}) turn {}",i,(i+turn),turn); getSecStrucState(i).setTurn('>', turn); getSecStrucState(i+turn).setTurn('<', turn); //Bracketed residues get the helix number @@ -998,7 +993,7 @@ private boolean isBonded(int i, int j) { (acc2p == i && acc2e < HBONDHIGHENERGY); if (hbond){ - logger.debug("*** H-bond from CO of " + i + " to NH of " + j); + logger.debug("*** H-bond from CO of {} to NH of {}", i, j); return true; } return false ; @@ -1105,7 +1100,7 @@ private void checkSetTurns() { private void checkSetHelix(int n, SecStrucType type){ int idx = n - 3; - logger.debug("Set helix " + type + " " + n + " " + idx); + logger.debug("Set helix {} {} {}", type, n, idx); for (int i = 1; i < groups.length-n; i++) { From 463ef0cbc3ae4422117ff86cf062c99aefa14b69 Mon Sep 17 00:00:00 2001 From: Dmytro Guzenko Date: Tue, 21 Aug 2018 16:27:47 -0700 Subject: [PATCH 30/37] fix for cloning with null seqres groups --- .../src/main/java/org/biojava/nbio/structure/ChainImpl.java | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java index d25a375891..de76404d2a 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java @@ -637,7 +637,9 @@ public List getSeqResGroups() { @Override public void setSeqResGroups(List groups){ for (Group g: groups){ - g.setChain(this); + if (g != null) { + g.setChain(this); + } } this.seqResGroups = groups; } From f4ebf9f37ed7be23c32dafccbd017d5bfe6e2842 Mon Sep 17 00:00:00 2001 From: Dmytro Guzenko Date: Tue, 21 Aug 2018 16:49:11 -0700 Subject: [PATCH 31/37] transformation ordering fix: total order required for the comparator --- .../nbio/structure/quaternary/BiologicalAssemblyBuilder.java | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java index 9faca71668..8c1832cf00 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java @@ -144,8 +144,9 @@ public int compare(BiologicalAssemblyTransformation t1, BiologicalAssemblyTransf // set sort order only if the two ids are identical if (t1.getId().equals(t2.getId())) { return chainIds.indexOf(t1.getChainId()) - chainIds.indexOf(t2.getChainId()); + } else { + return t1.getId().compareTo(t2.getId()); } - return 0; } }); } From 82ca5fe300bd6e37c3a7588b5ef379b44c500ac0 Mon Sep 17 00:00:00 2001 From: Dmytro Guzenko Date: Wed, 22 Aug 2018 11:14:30 -0700 Subject: [PATCH 32/37] typo in the test --- .../biojava/nbio/structure/test/io/TestBioassemblies.java | 5 ++--- 1 file changed, 2 insertions(+), 3 deletions(-) diff --git a/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java b/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java index c324a421bf..a18d453d7d 100644 --- a/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java +++ b/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java @@ -145,12 +145,11 @@ public void test4OPJ() throws IOException, StructureException { assertEquals(3, multiModelBioAssemblies.get(0).getPolyChains(0).size() + multiModelBioAssemblies.get(0).getPolyChains(1).size()); // 3 chains in flattened structure in bioassembly 1 assertEquals(3, flattenedBioAssemblies.get(0).getPolyChains().size()); - + // 3 chains divided into 2 models in bioassembly 2 - assertEquals(3, multiModelBioAssemblies.get(1).getPolyChains(0).size() + multiModelBioAssemblies.get(0).getPolyChains(1).size()); + assertEquals(3, multiModelBioAssemblies.get(1).getPolyChains(0).size() + multiModelBioAssemblies.get(1).getPolyChains(1).size()); // 3 chains in flattened structure in bioassembly 2 assertEquals(3, flattenedBioAssemblies.get(1).getPolyChains().size()); - // chain ids and names don't contain underscores in multimodel for (int modelIdx = 0; modelIdx Date: Tue, 28 Aug 2018 11:15:05 -0700 Subject: [PATCH 33/37] Fixing issue #797 and better docs and naming --- .../biojava/nbio/structure/EntityInfo.java | 26 ++++++++----------- ...ng.java => TestEntityResIndexMapping.java} | 17 ++++++++---- 2 files changed, 23 insertions(+), 20 deletions(-) rename biojava-structure/src/test/java/org/biojava/nbio/structure/{TestCompoundResIndexMapping.java => TestEntityResIndexMapping.java} (91%) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java index 29fffd6ee0..0ae91d6dfd 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java @@ -28,13 +28,7 @@ import org.slf4j.LoggerFactory; import java.io.Serializable; -import java.util.ArrayList; -import java.util.Collections; -import java.util.HashMap; -import java.util.List; -import java.util.Map; -import java.util.Set; -import java.util.TreeSet; +import java.util.*; /** * An object to contain the info from the PDB header for a Molecule. @@ -811,17 +805,19 @@ public List getChains(){ } private List getFirstModelChains() { - List firstModel = new ArrayList<>(); - outer: - for (String id: getChainIds()) { - for (Chain chain:chains) { - if (chain.getId().equals(id)) { - firstModel.add(chain); - break outer; + + Map firstModelChains = new LinkedHashMap<>(); + Set lookupChainIds = new HashSet<>(getChainIds()); + + for (Chain chain : chains) { + if (lookupChainIds.contains(chain.getId())) { + if (!firstModelChains.containsKey(chain.getId())) { + firstModelChains.put(chain.getId(), chain); } } } - return firstModel; + + return new ArrayList<>(firstModelChains.values()); } /** diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java similarity index 91% rename from biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java rename to biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java index 33ddb9ac86..6b8aeb9b75 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java @@ -31,7 +31,11 @@ import org.biojava.nbio.structure.io.PDBFileParser; import org.junit.Test; -public class TestCompoundResIndexMapping { +/** + * Various tests for functionality in {@link EntityInfo} and {@link org.biojava.nbio.structure.io.EntityFinder} + * @author Jose Duarte + */ +public class TestEntityResIndexMapping { private static final String PATH_TO_TEST_FILES = "/org/biojava/nbio/structure/io/"; @@ -67,7 +71,6 @@ public void test1SMT() throws IOException, StructureException { params.setAlignSeqRes(true); cache.setFileParsingParams(params); - StructureIO.setAtomCache(cache); cache.setUseMmCif(false); @@ -78,7 +81,11 @@ public void test1SMT() throws IOException, StructureException { assertEquals("First residue in 1smtA "+chainA.getAtomGroup(0).toString()+" should map to 24 in SEQRES",24,i); Chain chainB = s.getPolyChainByPDB("B"); i = chainB.getEntityInfo().getAlignedResIndex(chainB.getAtomGroup(0),chainB); - assertEquals("First residue in 1smtB "+chainA.getAtomGroup(0).toString()+" should map to 20 in SEQRES",20,i); + assertEquals("First residue in 1smtB "+chainB.getAtomGroup(0).toString()+" should map to 20 in SEQRES",20,i); + + // group with seqres index 19 is observed in chain B but not in chain A, we should still get the index back from getAlignedResIndex + i = chainA.getEntityInfo().getAlignedResIndex(chainA.getSeqResGroup(19),chainA); + assertEquals("Seqres residue 20 in 1smtA "+chainA.getSeqResGroup(19).toString()+" should map to 20 in SEQRES",20,i); checkAllResidues(s); } @@ -97,7 +104,7 @@ private void checkAllResidues(Structure s) { } // This doesn't work yet, since for raw files without a SEQRES, the seqres groups are not populated. Instead - // in that case Compound.getAlignedResIndex() returns residue numbers as given (without insertion codes) and + // in that case EntityInfo.getAlignedResIndex() returns residue numbers as given (without insertion codes) and // thus in general residues will not be correctly aligned between different chains of same entity. This breaks // cases like 3ddo (with no SEQRES records) where residue numbering is different in every chain of the one entity. // see https://github.com/eppic-team/eppic/issues/39 @@ -134,7 +141,7 @@ public void test3ddoRawNoSeqres() throws IOException, StructureException { - // this should work either with or without setAlignSeqRes, since the mapping happens in CompoundFinder + // this should work either with or without setAlignSeqRes, since the mapping happens in EntityFinder s = getStructure("3ddo_raw_noseqres.pdb.gz", false); assertEquals(1,s.getEntityInfos().size()); From 453aaf87532d3318ff8be3a186e982a7fb21502a Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Tue, 28 Aug 2018 14:59:13 -0700 Subject: [PATCH 34/37] Fixed part of a test and tagged it as Ignore --- .../structure/TestEntityResIndexMapping.java | 24 ++++++++++++++++--- 1 file changed, 21 insertions(+), 3 deletions(-) diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java index 6b8aeb9b75..f0926364b9 100644 --- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java +++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java @@ -24,11 +24,14 @@ import java.io.IOException; import java.io.InputStream; +import java.util.ArrayList; +import java.util.List; import java.util.zip.GZIPInputStream; import org.biojava.nbio.structure.align.util.AtomCache; import org.biojava.nbio.structure.io.FileParsingParameters; import org.biojava.nbio.structure.io.PDBFileParser; +import org.junit.Ignore; import org.junit.Test; /** @@ -108,13 +111,21 @@ private void checkAllResidues(Structure s) { // thus in general residues will not be correctly aligned between different chains of same entity. This breaks // cases like 3ddo (with no SEQRES records) where residue numbering is different in every chain of the one entity. // see https://github.com/eppic-team/eppic/issues/39 - //@Test + @Ignore + @Test public void test3ddoRawNoSeqres() throws IOException, StructureException { // 3ddo has 6 chains in 1 entity, all of them with different residue numbering (chain A is 1000+, chain B 2000+ ...) Structure s = getStructure("3ddo_raw_noseqres.pdb.gz", true); - assertEquals(1,s.getEntityInfos().size()); + List polyEntities = new ArrayList<>(); + for (EntityInfo entityInfo : s.getEntityInfos()) { + if (entityInfo.getType() == EntityType.POLYMER) { + polyEntities.add(entityInfo); + } + } + + assertEquals(1, polyEntities.size()); Chain chainA = s.getPolyChainByPDB("A"); Chain chainB = s.getPolyChainByPDB("B"); @@ -144,7 +155,14 @@ public void test3ddoRawNoSeqres() throws IOException, StructureException { // this should work either with or without setAlignSeqRes, since the mapping happens in EntityFinder s = getStructure("3ddo_raw_noseqres.pdb.gz", false); - assertEquals(1,s.getEntityInfos().size()); + polyEntities = new ArrayList<>(); + for (EntityInfo entityInfo : s.getEntityInfos()) { + if (entityInfo.getType() == EntityType.POLYMER) { + polyEntities.add(entityInfo); + } + } + + assertEquals(1, polyEntities.size()); chainA = s.getPolyChainByPDB("A"); chainB = s.getPolyChainByPDB("B"); From 282bf5b18811afd7305e968e4f053e3517eb5127 Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Wed, 29 Aug 2018 14:20:03 -0700 Subject: [PATCH 35/37] Fixing #784 --- .../symmetry/utils/BlastClustReader.java | 80 ++++++++----------- 1 file changed, 34 insertions(+), 46 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java index 9896e740ff..36963ae3be 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java @@ -20,6 +20,9 @@ */ package org.biojava.nbio.structure.symmetry.utils; +import org.slf4j.Logger; +import org.slf4j.LoggerFactory; + import java.io.BufferedReader; import java.io.IOException; import java.io.InputStream; @@ -33,21 +36,25 @@ public class BlastClustReader implements Serializable { private static final long serialVersionUID = 1L; + private static final Logger logger = LoggerFactory.getLogger(BlastClustReader.class); + private int sequenceIdentity = 0; - private List> clusters = new ArrayList>(); - private static final String coreUrl = "ftp://resources.rcsb.org/sequence/clusters/"; - private static List seqIdentities = Arrays.asList(30, 40, 50, 70, 90, 95, 100); + private List> clusters = new ArrayList<>(); + // https://cdn.rcsb.org/resources/sequence/clusters/bc-95.out + private static final String coreUrl = "https://cdn.rcsb.org/resources/sequence/clusters/"; + + private static final List seqIdentities = Arrays.asList(30, 40, 50, 70, 90, 95, 100); public BlastClustReader(int sequenceIdentity) { this.sequenceIdentity = sequenceIdentity; } - public List> getPdbChainIdClusters() { + public List> getPdbChainIdClusters() throws IOException { loadClusters(sequenceIdentity); return clusters; } - public Map getRepresentatives(String pdbId) { + public Map getRepresentatives(String pdbId) throws IOException { loadClusters(sequenceIdentity); String pdbIdUc = pdbId.toUpperCase(); @@ -64,7 +71,7 @@ public Map getRepresentatives(String pdbId) { return representatives; } - public String getRepresentativeChain(String pdbId, String chainId) { + public String getRepresentativeChain(String pdbId, String chainId) throws IOException { loadClusters(sequenceIdentity); String pdbChainId = pdbId.toUpperCase() + "." + chainId; @@ -77,7 +84,7 @@ public String getRepresentativeChain(String pdbId, String chainId) { return ""; } - public int indexOf(String pdbId, String chainId) { + public int indexOf(String pdbId, String chainId) throws IOException { loadClusters(sequenceIdentity); String pdbChainId = pdbId.toUpperCase() + "." + chainId; @@ -91,7 +98,7 @@ public int indexOf(String pdbId, String chainId) { return -1; } - public List> getPdbChainIdClusters(String pdbId) { + public List> getPdbChainIdClusters(String pdbId) throws IOException { loadClusters(sequenceIdentity); String pdbIdUpper = pdbId.toUpperCase(); @@ -107,7 +114,7 @@ public List> getPdbChainIdClusters(String pdbId) { return matches; } - public List> getChainIdsInEntry(String pdbId) { + public List> getChainIdsInEntry(String pdbId) throws IOException { loadClusters(sequenceIdentity); List> matches = new ArrayList>(); @@ -131,55 +138,36 @@ public List> getChainIdsInEntry(String pdbId) { return matches; } - private void loadClusters(int sequenceIdentity) { + private void loadClusters(int sequenceIdentity) throws IOException { // load clusters only once if (clusters.size() > 0) { return; } if (!seqIdentities.contains(sequenceIdentity)) { - System.err.println("Error: representative chains are not available for %sequence identity: " - + sequenceIdentity); + logger.error("Representative chains are not available for %sequence identity: {}", sequenceIdentity); return; } - try { - URL u = new URL(coreUrl + "bc-" + sequenceIdentity + ".out"); - InputStream stream = u.openStream(); - // URLConnection connection = u.openConnection(); - // connection.setConnectTimeout(60000); - // InputStream stream = connection.getInputStream(); - - if (stream != null) { - BufferedReader reader = new BufferedReader(new InputStreamReader(stream)); - - String line = null; - try { - while ((line = reader.readLine()) != null) { - line = line.replaceAll("_", "."); - List cluster = Arrays.asList(line.split(" ")); - clusters.add(cluster); - } - reader.close(); - stream.close(); - } catch (IOException e) { - //e.printStackTrace(); - } finally { -// try { -// System.out.println("closing reader"); -// reader.close(); -// stream.close(); -// } catch (IOException e) { -// e.printStackTrace(); -// } - } - } + String urlString = coreUrl + "bc-" + sequenceIdentity + ".out"; + URL u = new URL(urlString); + InputStream stream = u.openStream(); - } catch (Exception e) { - e.printStackTrace(); + if (stream != null) { + BufferedReader reader = new BufferedReader(new InputStreamReader(stream)); + + String line = null; + while ((line = reader.readLine()) != null) { + line = line.replaceAll("_", "."); + List cluster = Arrays.asList(line.split(" ")); + clusters.add(cluster); + } + reader.close(); + stream.close(); + } else { + throw new IOException("Got null stream for URL " + urlString); } - return; } } From de9652b663f03961b8dec32e2b2590a27d3d168d Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Wed, 29 Aug 2018 14:39:41 -0700 Subject: [PATCH 36/37] Not altering the exceptions in signature, keeping what we had with better logging --- .../symmetry/utils/BlastClustReader.java | 58 ++++++++++--------- 1 file changed, 32 insertions(+), 26 deletions(-) diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java index 36963ae3be..cdd9a67407 100644 --- a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java +++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java @@ -49,16 +49,16 @@ public BlastClustReader(int sequenceIdentity) { this.sequenceIdentity = sequenceIdentity; } - public List> getPdbChainIdClusters() throws IOException { + public List> getPdbChainIdClusters() { loadClusters(sequenceIdentity); return clusters; } - public Map getRepresentatives(String pdbId) throws IOException { + public Map getRepresentatives(String pdbId) { loadClusters(sequenceIdentity); String pdbIdUc = pdbId.toUpperCase(); - Map representatives = new LinkedHashMap(); + Map representatives = new LinkedHashMap<>(); for (List cluster: clusters) { // map fist match to representative for (String chainId: cluster) { @@ -71,7 +71,7 @@ public Map getRepresentatives(String pdbId) throws IOException { return representatives; } - public String getRepresentativeChain(String pdbId, String chainId) throws IOException { + public String getRepresentativeChain(String pdbId, String chainId) { loadClusters(sequenceIdentity); String pdbChainId = pdbId.toUpperCase() + "." + chainId; @@ -84,7 +84,7 @@ public String getRepresentativeChain(String pdbId, String chainId) throws IOExce return ""; } - public int indexOf(String pdbId, String chainId) throws IOException { + public int indexOf(String pdbId, String chainId) { loadClusters(sequenceIdentity); String pdbChainId = pdbId.toUpperCase() + "." + chainId; @@ -98,7 +98,7 @@ public int indexOf(String pdbId, String chainId) throws IOException { return -1; } - public List> getPdbChainIdClusters(String pdbId) throws IOException { + public List> getPdbChainIdClusters(String pdbId) { loadClusters(sequenceIdentity); String pdbIdUpper = pdbId.toUpperCase(); @@ -114,7 +114,7 @@ public List> getPdbChainIdClusters(String pdbId) throws IOException return matches; } - public List> getChainIdsInEntry(String pdbId) throws IOException { + public List> getChainIdsInEntry(String pdbId) { loadClusters(sequenceIdentity); List> matches = new ArrayList>(); @@ -138,7 +138,7 @@ public List> getChainIdsInEntry(String pdbId) throws IOException { return matches; } - private void loadClusters(int sequenceIdentity) throws IOException { + private void loadClusters(int sequenceIdentity) { // load clusters only once if (clusters.size() > 0) { return; @@ -149,24 +149,30 @@ private void loadClusters(int sequenceIdentity) throws IOException { return; } - String urlString = coreUrl + "bc-" + sequenceIdentity + ".out"; - URL u = new URL(urlString); - InputStream stream = u.openStream(); - - if (stream != null) { - BufferedReader reader = new BufferedReader(new InputStreamReader(stream)); - - String line = null; - while ((line = reader.readLine()) != null) { - line = line.replaceAll("_", "."); - List cluster = Arrays.asList(line.split(" ")); - clusters.add(cluster); - } - reader.close(); - stream.close(); - } else { - throw new IOException("Got null stream for URL " + urlString); - } + String urlString = coreUrl + "bc-" + sequenceIdentity + ".out"; + + try { + + URL u = new URL(urlString); + InputStream stream = u.openStream(); + + if (stream != null) { + BufferedReader reader = new BufferedReader(new InputStreamReader(stream)); + + String line = null; + while ((line = reader.readLine()) != null) { + line = line.replaceAll("_", "."); + List cluster = Arrays.asList(line.split(" ")); + clusters.add(cluster); + } + reader.close(); + stream.close(); + } else { + throw new IOException("Got null stream for URL " + urlString); + } + } catch (IOException e) { + logger.error("Could not get sequence clusters from URL " + urlString + ". Error: " + e.getMessage()); + } } From 64eccdaa3e4c4b0b353b3d991ecc163763aa7d7d Mon Sep 17 00:00:00 2001 From: Jose Manuel Duarte Date: Wed, 29 Aug 2018 16:37:05 -0700 Subject: [PATCH 37/37] [maven-release-plugin] prepare release biojava-5.1.0 --- biojava-aa-prop/pom.xml | 6 +++--- biojava-alignment/pom.xml | 4 ++-- biojava-core/pom.xml | 2 +- biojava-genome/pom.xml | 6 +++--- biojava-integrationtest/pom.xml | 4 ++-- biojava-modfinder/pom.xml | 4 ++-- biojava-ontology/pom.xml | 2 +- biojava-protein-disorder/pom.xml | 4 ++-- biojava-structure-gui/pom.xml | 6 +++--- biojava-structure/pom.xml | 6 +++--- biojava-survival/pom.xml | 2 +- biojava-ws/pom.xml | 4 ++-- pom.xml | 4 ++-- 13 files changed, 27 insertions(+), 27 deletions(-) diff --git a/biojava-aa-prop/pom.xml b/biojava-aa-prop/pom.xml index 8e1d45bc2f..fe4b22fc76 100644 --- a/biojava-aa-prop/pom.xml +++ b/biojava-aa-prop/pom.xml @@ -2,7 +2,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 4.0.0 biojava-aa-prop @@ -70,12 +70,12 @@ org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 org.biojava biojava-structure - 5.1.0-SNAPSHOT + 5.1.0 diff --git a/biojava-alignment/pom.xml b/biojava-alignment/pom.xml index c620f57c9d..edef4a4126 100644 --- a/biojava-alignment/pom.xml +++ b/biojava-alignment/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-alignment biojava-alignment @@ -47,7 +47,7 @@ org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 compile diff --git a/biojava-core/pom.xml b/biojava-core/pom.xml index e53410e282..1af462e7f2 100644 --- a/biojava-core/pom.xml +++ b/biojava-core/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 4.0.0 biojava-core diff --git a/biojava-genome/pom.xml b/biojava-genome/pom.xml index c3eebdd65f..8c290fb3ce 100644 --- a/biojava-genome/pom.xml +++ b/biojava-genome/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 4.0.0 biojava-genome @@ -85,13 +85,13 @@ org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 compile org.biojava biojava-alignment - 5.1.0-SNAPSHOT + 5.1.0 compile diff --git a/biojava-integrationtest/pom.xml b/biojava-integrationtest/pom.xml index 9e13910c63..cd9ce7282e 100644 --- a/biojava-integrationtest/pom.xml +++ b/biojava-integrationtest/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-integrationtest jar @@ -28,7 +28,7 @@ org.biojava biojava-structure - 5.1.0-SNAPSHOT + 5.1.0 diff --git a/biojava-modfinder/pom.xml b/biojava-modfinder/pom.xml index 2424dfb8ce..b726e28519 100644 --- a/biojava-modfinder/pom.xml +++ b/biojava-modfinder/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-modfinder biojava-modfinder @@ -31,7 +31,7 @@ org.biojava biojava-structure - 5.1.0-SNAPSHOT + 5.1.0 jar compile diff --git a/biojava-ontology/pom.xml b/biojava-ontology/pom.xml index ada60c174c..41cfe229df 100644 --- a/biojava-ontology/pom.xml +++ b/biojava-ontology/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-ontology diff --git a/biojava-protein-disorder/pom.xml b/biojava-protein-disorder/pom.xml index ae653bdf00..ca7c3130a5 100644 --- a/biojava-protein-disorder/pom.xml +++ b/biojava-protein-disorder/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-protein-disorder jar @@ -63,7 +63,7 @@ org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 diff --git a/biojava-structure-gui/pom.xml b/biojava-structure-gui/pom.xml index 8b96b88dea..7f0e8d9eac 100644 --- a/biojava-structure-gui/pom.xml +++ b/biojava-structure-gui/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 4.0.0 biojava-structure-gui @@ -27,13 +27,13 @@ org.biojava biojava-structure - 5.1.0-SNAPSHOT + 5.1.0 compile org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 compile diff --git a/biojava-structure/pom.xml b/biojava-structure/pom.xml index 6c63cbf2d2..88ee84457e 100644 --- a/biojava-structure/pom.xml +++ b/biojava-structure/pom.xml @@ -4,7 +4,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-structure biojava-structure @@ -40,13 +40,13 @@ org.biojava biojava-alignment - 5.1.0-SNAPSHOT + 5.1.0 compile org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 compile diff --git a/biojava-survival/pom.xml b/biojava-survival/pom.xml index a3a9653424..a90e42d981 100644 --- a/biojava-survival/pom.xml +++ b/biojava-survival/pom.xml @@ -4,7 +4,7 @@ org.biojava biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-survival diff --git a/biojava-ws/pom.xml b/biojava-ws/pom.xml index 6c38dfd02e..e7282143aa 100644 --- a/biojava-ws/pom.xml +++ b/biojava-ws/pom.xml @@ -3,7 +3,7 @@ biojava org.biojava - 5.1.0-SNAPSHOT + 5.1.0 biojava-ws biojava-ws @@ -19,7 +19,7 @@ org.biojava biojava-core - 5.1.0-SNAPSHOT + 5.1.0 compile diff --git a/pom.xml b/pom.xml index 8f01d73591..a71b8756e6 100644 --- a/pom.xml +++ b/pom.xml @@ -12,7 +12,7 @@ org.biojava biojava pom - 5.1.0-SNAPSHOT + 5.1.0 biojava BioJava is an open-source project dedicated to providing a Java framework for processing biological data. It provides analytical and statistical routines, parsers for common file formats and allows the @@ -48,7 +48,7 @@ scm:git:git@github.com:biojava/biojava.git https://github.com/biojava/biojava - HEAD + biojava-5.1.0