+ * ABITrace is a class for managing ABI file information,
+ * it is capable of opening an ABI file and storing
+ * the most important fields, which can be recalled as simple java types. It can also return
+ * an image corresponding to the trace.
+ * It has three constructors with input types File, URL, and byte[].
+ * ABI files contain two sets of basecall and sequence data, one that was originally
+ * created programatically and the other, which is an editable copy. This version of this object
+ * only references the original unedited data.
+ */
+public class ABITrace {
+
+ //the next three lines are the important persistent data
+ private String sequence;
+ private int A[], G[], C[], T[], baseCalls[], qCalls[];
+ private int traceLength, seqLength;
+
+ //This is the actual file data.
+ private byte[] traceData;
+
+ //the next four declaration lines comprise the file index information
+ private int macJunk = 0; //sometimes when macintosh files are
+ //FTPed in binary form, they have 128 bytes
+ //of crap pre-pended to them. This constant
+ //allows ABITrace to handle that in a way that
+ //is invisible to the user.
+ private static final int absIndexBase = 26; //The file location of the Index pointer
+ private int PLOC, PCON;
+
+ //the next declaration is for the actual file pointers
+ private int DATA9, DATA10, DATA11, DATA12, PBAS2, FWO;
+
+ /**
+ * The File constructor opens a local ABI file and parses the content.
+ *
+ * @param ABIFile is a java.io.File on the local file system.
+ * @throws IOException if there is a problem reading the file.
+ * @throws IllegalArgumentException if the file is not a valid ABI file.
+ */
+ public ABITrace(File ABIFile) throws IOException
+ {
+ FileInputStream fis = new FileInputStream(ABIFile);
+ BufferedInputStream bis = new BufferedInputStream(fis);
+ ABITraceInit(bis);
+ fis.close();
+ }
+
+ /**
+ * The URL constructor opens an ABI file from any URL.
+ *
+ * @param ABIFile is a java.net.URL for an ABI trace file.
+ * @throws IOException if there is a problem reading from the URL.
+ * @throws IllegalArgumentException if the URL does not contain a valid ABI file.
+ */
+ public ABITrace( URL ABIFile ) throws IOException
+ {
+ InputStream is = ABIFile.openStream();
+ BufferedInputStream bis = new BufferedInputStream(is);
+ ABITraceInit(bis);
+ is.close();
+ }
+
+ /**
+ * Helper method for constructors
+ *
+ * @param bis - BufferedInputStream
+ * @throws IOException if there is a problem reading from the BufferedInputStream
+ */
+ private void ABITraceInit(BufferedInputStream bis) throws IOException{
+ byte[] bytes = null;
+ ByteArrayOutputStream baos = new ByteArrayOutputStream();
+ int b;
+ while ((b = bis.read()) >= 0)
+ {
+ baos.write(b);
+ }
+ bis.close(); baos.close();
+ bytes = baos.toByteArray();
+ initData(bytes);
+ }
+
+ /**
+ * The byte[] constructor parses an ABI file represented as a byte array.
+ *
+ * @param ABIFileData - byte array
+ * @throws IllegalArgumentException if the data does not represent a valid ABI file.
+ */
+ public ABITrace(byte[] ABIFileData) {
+ initData(ABIFileData);
+ }
+
+ /**
+ * Returns the length of the sequence (number of bases) in this trace.
+ *
+ * @return int seqLength
+ */
+ public int getSequenceLength() {
+ return seqLength;
+ }
+
+ /**
+ * Returns the length of the trace (number of x-coordinate points in the graph).
+ *
+ * @return int traceLength
+ */
+ public int getTraceLength() {
+ return traceLength;
+ }
+
+ /**
+ * Returns an int[] array that represents the basecalls - each int in the
+ * array corresponds to an x-coordinate point in the graph that is a peak (a base location).
+ *
+ * @return int[] Basecalls
+ */
+ public int[] getBasecalls() {
+ return baseCalls;
+ }
+
+ /**
+ * Returns an int[] array that represents the quality - each int in the
+ * array corresponds to an quality value 90-255) in the graph at a base location).
+ *
+ * @return int[] qCalls
+ */
+ public int[] getQcalls() {
+ return qCalls;
+ }
+
+ /**
+ * Returns the original programmatically determined (unedited) sequence as a AbstractSequence.
+ *
+ * @return AbstractSequence sequence
+ */
+ public AbstractSequence getSequence() throws CompoundNotFoundException {
+ DNASequenceCreator creator = new DNASequenceCreator(ABITracerCompoundSet.getABITracerCompoundSet());
+ return creator.getSequence(sequence, 0);
+ }
+
+ /**
+ * Returns one of the four traces - all of the y-coordinate values,
+ * each of which correspond to a single x-coordinate relative to the
+ * position in the array, so that if element 4 in the array is 972, then
+ * x is 4 and y is 972 for that point.
+ *
+ * @param base - the DNA String to retrieve the trace values for
+ * @return an array of ints giving the entire trace for that base
+ * @throws CompoundNotFoundException if the base is not valid
+ */
+ public int[] getTrace (String base) throws CompoundNotFoundException {
+ if (base.equals("A")) {
+ return A;
+ } else if (base.equals("C")) {
+ return C;
+ } else if (base.equals("G")) {
+ return G;
+ } else if (base.equals("T")) {
+ return T;
+ } else {
+ throw new CompoundNotFoundException("Don't know base: " + base);
+ }
+ }
+
+ /**
+ * Returns a BufferedImage that represents the entire trace. The height can be set precisely in
+ * pixels, the width in pixels is determined by the scaling factor times the number
+ * of points in the trace (getTraceLength()). The entire trace is represented
+ * in the returned image.
+ *
+ * @param imageHeight - desired height of the image in pixels.
+ * @param widthScale - how many horizontal pixels to use to represent a single x-coordinate (try 2).
+ * @return BufferedImage image
+ */
+ public BufferedImage getImage(int imageHeight, int widthScale) {
+ BufferedImage out = new BufferedImage(traceLength * widthScale, imageHeight, BufferedImage.TYPE_BYTE_INDEXED);
+ Graphics2D g = out.createGraphics();
+ Color acolor = Color.green.darker();
+ Color ccolor = Color.blue;
+ Color gcolor = Color.black;
+ Color tcolor = Color.red;
+ Color ncolor = Color.pink;
+ double scale = calculateScale(imageHeight);
+ int[] bc = baseCalls;
+ char[] seq = sequence.toCharArray();
+ g.setBackground(Color.white);
+ g.clearRect(0, 0, traceLength * widthScale, imageHeight);
+ int here = 0;
+ int basenum = 0;
+ for (int q = 1; q <= 5; q++) {
+ for (int x = 0; x <= traceLength - 2; x++) {
+ if (q == 1) {
+ g.setColor(acolor);
+ g.drawLine(2 * x, transmute(A[x], imageHeight, scale),
+ 2 * (x + 1), transmute(A[x + 1], imageHeight, scale));
+ }
+ if (q == 2) {
+ g.setColor(ccolor);
+ g.drawLine(2 * x, transmute(C[x], imageHeight, scale),
+ 2 * (x + 1), transmute(C[x + 1], imageHeight, scale));
+ }
+ if (q == 3) {
+ g.setColor(tcolor);
+ g.drawLine(2 * x, transmute(T[x], imageHeight, scale),
+ 2 * (x + 1), transmute(T[x + 1], imageHeight, scale));
+ }
+ if (q == 4) {
+ g.setColor(gcolor);
+ g.drawLine(2 * x, transmute(G[x], imageHeight, scale),
+ 2 * (x + 1), transmute(G[x + 1], imageHeight, scale));
+ }
+ if (q == 5) {
+ if ((here > bc.length - 1) || (basenum > seq.length - 1)) break;
+ if (bc[here] == x) {
+ g.drawLine(2 * x, transmute(-2, imageHeight, 1.0),
+ 2 * x, transmute(-7, imageHeight, 1.0));
+ if ((basenum + 1) % 10 == 0) //if the basecount is divisible by ten
+ //add a number
+ {
+ g.drawLine(2 * x, transmute(-20, imageHeight, 1.0),
+ 2 * x, transmute(-25, imageHeight, 1.0));
+ g.drawString(Integer.toString(basenum + 1),
+ 2 * x - 3, transmute(-36, imageHeight, 1.0));
+ }
+ switch (seq[basenum]) {
+ case 'A':
+ case 'a':
+ g.setColor(acolor);
+ break;
+ case 'C':
+ case 'c':
+ g.setColor(ccolor);
+ break;
+ case 'G':
+ case 'g':
+ g.setColor(gcolor);
+ break;
+ case 'T':
+ case 't':
+ g.setColor(tcolor);
+ break;
+ default:
+ g.setColor(ncolor);
+ }
+ g.drawChars(seq, basenum, 1,
+ 2 * x - 3, transmute(-18, imageHeight, 1.0));
+ g.setColor(Color.black);
+ here++;
+ basenum++;
+ }
+ }
+ }
+ }
+ return out;
+ }
+
+ /**
+ * Utility method to translate y coordinates from graph space (where up is greater)
+ * to image space (where down is greater).
+ *
+ * @param ya
+ * @param height
+ * @param scale
+ * @return - translated y coordinates from graph space (where up is greater) to image space
+ */
+ private int transmute(int ya, int height, double scale) {
+ return (height - 45 - (int) (ya * scale));
+ }
+
+ //calculates the necessary scaling to allow the trace to fit vertically
+ //in the space specified.
+
+ /**
+ * Returns the scaling factor necessary to allow all of the traces to fit vertically
+ * into the specified space.
+ *
+ * @param height - required height in pixels
+ * @return - scaling factor
+ */
+ private double calculateScale(int height) {
+ double newScale = 0.0;
+ double max = (double) getMaximum();
+ double ht = (double) height;
+ newScale = ((ht - 50.0)) / max;
+ return newScale;
+ }
+
+ /**
+ * Get the maximum height of any of the traces. The data is persisted for performance
+ * in the event of multiple calls, but it initialized lazily.
+ *
+ * @return - maximum height of any of the traces
+ */
+ private int getMaximum() {
+ int max = 0;
+ for (int x = 0; x <= T.length - 1; x++) {
+ if (T[x] > max) max = T[x];
+ if (A[x] > max) max = A[x];
+ if (C[x] > max) max = C[x];
+ if (G[x] > max) max = G[x];
+ }
+ return max;
+ }
+
+ /**
+ * Initialize all of the data fields for this object.
+ *
+ * @param fileData - data for object
+ * @throws IllegalArgumentException which will propagate to all of the constructors.
+ */
+ private void initData(byte[] fileData) {
+ traceData = fileData;
+ if (isABI()) {
+ setIndex();
+ setBasecalls();
+ setQcalls();
+ setSeq();
+ setTraces();
+ } else throw new IllegalArgumentException("Not a valid ABI file.");
+ }
+
+ /**
+ * Shuffle the pointers to point to the proper spots in the trace, then load the
+ * traces into their arrays.
+ */
+ private void setTraces() {
+ int pointers[] = new int[4]; //alphabetical, 0=A, 1=C, 2=G, 3=T
+ int datas[] = new int[4];
+ char order[] = new char[4];
+
+ datas[0] = DATA9;
+ datas[1] = DATA10;
+ datas[2] = DATA11;
+ datas[3] = DATA12;
+
+ for (int i = 0; i <= 3; i++) {
+ order[i] = (char) traceData[FWO + i];
+ }
+
+ for (int i = 0; i <= 3; i++) {
+ switch (order[i]) {
+ case 'A':
+ case 'a':
+ pointers[0] = datas[i];
+ break;
+ case 'C':
+ case 'c':
+ pointers[1] = datas[i];
+ break;
+ case 'G':
+ case 'g':
+ pointers[2] = datas[i];
+ break;
+ case 'T':
+ case 't':
+ pointers[3] = datas[i];
+ break;
+ default:
+ throw new IllegalArgumentException("Trace contains illegal values.");
+ }
+ }
+
+ A = new int[traceLength];
+ C = new int[traceLength];
+ G = new int[traceLength];
+ T = new int[traceLength];
+
+ for (int i = 0; i <= 3; i++) {
+ byte[] qq = new byte[traceLength * 2];
+ getSubArray(qq, pointers[i]);
+ DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq));
+ for (int x = 0; x <= traceLength - 1; x++) {
+ try {
+ if (i == 0) A[x] = (int) dis.readShort();
+ if (i == 1) C[x] = (int) dis.readShort();
+ if (i == 2) G[x] = (int) dis.readShort();
+ if (i == 3) T[x] = (int) dis.readShort();
+ } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong.
+ {
+ throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams.");
+ }
+ }
+ }
+ return;
+ }
+
+ /**
+ * Fetch the sequence from the trace data.
+ */
+ private void setSeq() {
+ char tempseq[] = new char[seqLength];
+ for (int x = 0; x <= seqLength - 1; ++x) {
+ tempseq[x] = (char) traceData[PBAS2 + x];
+ }
+ sequence = new String(tempseq);
+ }
+
+ /**
+ * Fetch the quality calls from the trace data.
+ */
+ private void setQcalls() {
+ qCalls = new int[seqLength];
+ byte[] qq = new byte[seqLength];
+ getSubArray(qq, PCON);
+ DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq));
+ for (int i = 0; i <= seqLength - 1; ++i) {
+ try {
+ qCalls[i] = (int) dis.readByte();
+ } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong.
+ {
+ throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams.");
+ }
+ }
+ }
+
+ /**
+ * Fetch the basecalls from the trace data.
+ */
+ private void setBasecalls() {
+ baseCalls = new int[seqLength];
+ byte[] qq = new byte[seqLength * 2];
+ getSubArray(qq, PLOC);
+ DataInputStream dis = new DataInputStream(new ByteArrayInputStream(qq));
+ for (int i = 0; i <= seqLength - 1; ++i) {
+ try {
+ baseCalls[i] = (int) dis.readShort();
+ } catch (IOException e)//This shouldn't happen. If it does something must be seriously wrong.
+ {
+ throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams.");
+ }
+ }
+ }
+
+ /**
+ * Sets up all of the initial pointers to the important records in TraceData.
+ */
+ private void setIndex() {
+ int DataCounter, PBASCounter, PLOCCounter, PCONCounter, NumRecords, indexBase;
+ byte[] RecNameArray = new byte[4];
+ String RecName;
+
+ DataCounter = 0;
+ PBASCounter = 0;
+ PLOCCounter = 0;
+ PCONCounter = 0;
+
+ indexBase = getIntAt(absIndexBase + macJunk);
+ NumRecords = getIntAt(absIndexBase - 8 + macJunk);
+
+ for (int record = 0; record <= NumRecords - 1; record++) {
+ getSubArray(RecNameArray, (indexBase + (record * 28)));
+ RecName = new String(RecNameArray);
+ if (RecName.equals("FWO_"))
+ FWO = indexBase + (record * 28) + 20;
+ if (RecName.equals("DATA")) {
+ ++DataCounter;
+ if (DataCounter == 9)
+ DATA9 = indexBase + (record * 28) + 20;
+ if (DataCounter == 10)
+ DATA10 = indexBase + (record * 28) + 20;
+ if (DataCounter == 11)
+ DATA11 = indexBase + (record * 28) + 20;
+ if (DataCounter == 12)
+ DATA12 = indexBase + (record * 28) + 20;
+ }
+ if (RecName.equals("PBAS")) {
+ ++PBASCounter;
+ if (PBASCounter == 2)
+ PBAS2 = indexBase + (record * 28) + 20;
+ }
+ if (RecName.equals("PLOC")) {
+ ++PLOCCounter;
+ if (PLOCCounter == 2)
+ PLOC = indexBase + (record * 28) + 20;
+ }
+ if (RecName.equals("PCON")) {
+ ++PCONCounter;
+ if (PCONCounter == 2)
+ PCON = indexBase + (record * 28) + 20;
+ }
+
+ } //next record
+ traceLength = getIntAt(DATA12 - 8);
+ seqLength = getIntAt(PBAS2 - 4);
+ PLOC = getIntAt(PLOC) + macJunk;
+ DATA9 = getIntAt(DATA9) + macJunk;
+ DATA10 = getIntAt(DATA10) + macJunk;
+ DATA11 = getIntAt(DATA11) + macJunk;
+ DATA12 = getIntAt(DATA12) + macJunk;
+ PBAS2 = getIntAt(PBAS2) + macJunk;
+ PCON = getIntAt(PCON) + macJunk;
+ }
+
+ /**
+ * Utility method to return an int beginning at pointer in the TraceData array.
+ *
+ * @param pointer - beginning of trace array
+ * @return - int beginning at pointer in trace array
+ */
+ private int getIntAt(int pointer) {
+ int out = 0;
+ byte[] temp = new byte[4];
+ getSubArray(temp, pointer);
+ try {
+ DataInputStream dis = new DataInputStream(new ByteArrayInputStream(temp));
+ out = dis.readInt();
+ } catch (IOException e) //This shouldn't happen. If it does something must be seriously wrong.
+ {
+ throw new IllegalStateException("Unexpected IOException encountered while manipulating internal streams.");
+ }
+ return out;
+ }
+
+ /**
+ * A utility method which fills array b with data from the trace starting at traceDataOffset.
+ *
+ * @param b - trace byte array
+ * @param traceDataOffset - starting point
+ */
+ private void getSubArray(byte[] b, int traceDataOffset) {
+ for (int x = 0; x <= b.length - 1; x++) {
+ b[x] = traceData[traceDataOffset + x];
+ }
+ }
+
+ /**
+ * Test to see if the file is ABI format by checking to see that the first three bytes
+ * are "ABI". Also handle the special case where 128 bytes were prepended to the file
+ * due to binary FTP from an older macintosh system.
+ *
+ * @return - if format of ABI file is correct
+ */
+ private boolean isABI() {
+ char ABI[] = new char[4];
+
+ for (int i = 0; i <= 2; i++) {
+ ABI[i] = (char) traceData[i];
+ }
+ if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) {
+ return true;
+ } else {
+ for (int i = 128; i <= 130; i++) {
+ ABI[i-128] = (char) traceData[i];
+ }
+ if (ABI[0] == 'A' && (ABI[1] == 'B' && ABI[2] == 'I')) {
+ macJunk = 128;
+ return true;
+ } else
+ return false;
+ }
+ }
+}
diff --git a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java
index 4ce8c0d3ba..06cfd283f9 100644
--- a/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java
+++ b/biojava-core/src/main/java/org/biojava/nbio/core/sequence/loader/UniprotProxySequenceReader.java
@@ -76,7 +76,9 @@ public class UniprotProxySequenceReader implements ProxySequ
private static final String TREMBLID_PATTERN = "[A-NR-Z][0-9]([A-Z][A-Z0-9]{2}[0-9]){1,2}";
public static final Pattern UP_AC_PATTERN = Pattern.compile("(" + SPID_PATTERN + "|" + TREMBLID_PATTERN + ")");
- private static String uniprotbaseURL = "http://www.uniprot.org"; //"http://pir.uniprot.org";
+ public static final String DEFAULT_UNIPROT_BASE_URL = "https://www.uniprot.org";
+
+ private static String uniprotbaseURL = DEFAULT_UNIPROT_BASE_URL;
private static String uniprotDirectoryCache = null;
private String sequence;
private CompoundSet compoundSet;
diff --git a/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java
new file mode 100644
index 0000000000..719b813d00
--- /dev/null
+++ b/biojava-core/src/test/java/org/biojava/nbio/core/sequence/io/ABITracerTest.java
@@ -0,0 +1,96 @@
+/*
+ * BioJava development code
+ *
+ * This code may be freely distributed and modified under the
+ * terms of the GNU Lesser General Public Licence. This should
+ * be distributed with the code. If you do not have a copy,
+ * see:
+ *
+ * http://www.gnu.org/copyleft/lesser.html
+ *
+ * Copyright for this code is held jointly by the individual
+ * authors. These should be listed in @author doc comments.
+ *
+ * For more information on the BioJava project and its aims,
+ * or to join the biojava-l mailing list, visit the home page
+ * at:
+ *
+ * http://www.biojava.org/
+ *
+ */
+
+package org.biojava.nbio.core.sequence.io;
+
+import java.awt.image.BufferedImage;
+import java.io.File;
+import java.net.URL;
+import org.junit.*;
+
+/**
+ * Test file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/3730.ab1
+ * The test data for comparing the results from ABITrace.java for file 3730.ab1 is from https://github.com/biopython/biopython/blob/master/Tests/Abi/test_data
+ */
+public class ABITracerTest {
+
+ private String sequence = "GGGCGAGCKYYAYATTTTGGCAAGAATTGAGCTCTATGGCCACAACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGGGCGGCAGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAARACCCGCGCCGAGGTGAARTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAAGGGGCAYCGCACCTTTC";
+ private int[] qual = {20, 3, 4, 4, 4, 6, 4, 4, 0, 0, 0, 6, 0, 10, 20, 26, 22, 17, 21, 31, 29, 32, 28, 18, 23, 17, 19, 35, 36, 50, 39, 50, 50, 50, 50, 50, 25, 35, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 39, 33, 20, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 50, 35, 31, 23, 28, 31, 21, 43, 39, 35, 24, 30, 26, 35, 31, 50, 50, 50, 50, 50, 50, 50, 50, 50, 39, 31, 24, 39, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 43, 43, 50, 50, 50, 50, 50, 31, 31, 31, 31, 50, 50, 50, 50, 50, 50, 50, 50, 31, 31, 35, 50, 50, 50, 50, 31, 36, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 36, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 40, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 55, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 43, 43, 50, 43, 43, 50, 50, 50, 50, 50, 50, 50, 50, 50, 50, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 28, 35, 28, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 37, 38, 21, 28, 35, 28, 28, 35, 35, 35, 35, 35, 35, 35, 36, 36, 21, 39, 35, 35, 35, 39, 35, 37, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 35, 28, 28, 35, 35, 28, 28, 35, 35, 35, 36, 36, 22, 39, 35, 35, 35, 35, 35, 35, 37, 38, 28, 35, 21, 36, 36, 37, 35, 35, 20, 39, 39, 35, 35, 35, 35, 37, 38, 28, 35, 37, 34, 35, 24, 24, 27, 25, 20, 24, 37, 35, 27, 21, 20, 21, 27, 17, 20, 24, 32, 26, 20, 12, 20, 10, 20, 24, 25, 23, 20, 32, 24, 24, 23, 20, 24, 23, 18, 34, 34, 34, 22, 26, 24, 24, 18, 22, 22, 23, 25, 20, 12, 20, 24, 23, 24, 23, 22, 20, 20, 0, 20, 24, 23, 20, 8, 10, 4, 20, 20, 3, 7, 19, 20, 4, 4, 7, 7, 0, 7, 11, 18, 8, 3, 23, 23, 20, 11, 4, 20, 18, 12, 20, 20, 20, 4, 20, 4, 2, 3, 21, 21, 21, 21, 10, 15, 14, 15, 19, 2, 4, 3, 6, 11, 3, 4, 6, 21, 16, 20, 11, 1, 4, 12, 0, 15, 8, 1, 3, 3, 12, 1, 11, 20, 4};
+ private int[] base = {2, 13, 38, 51, 67, 78, 92, 118, 138, 162, 181, 191, 210, 222, 239, 253, 266, 280, 288, 304, 317, 333, 347, 359, 375, 386, 394, 406, 418, 433, 444, 457, 472, 482, 496, 506, 519, 529, 544, 557, 569, 579, 590, 601, 614, 626, 638, 649, 663, 673, 686, 706, 715, 731, 740, 753, 765, 777, 787, 799, 813, 826, 838, 854, 863, 876, 892, 901, 913, 929, 937, 948, 960, 970, 981, 993, 1004, 1017, 1034, 1045, 1056, 1068, 1080, 1091, 1103, 1115, 1126, 1138, 1148, 1160, 1177, 1187, 1199, 1211, 1222, 1232, 1243, 1254, 1268, 1279, 1294, 1307, 1319, 1330, 1341, 1352, 1362, 1374, 1388, 1398, 1411, 1422, 1433, 1444, 1456, 1466, 1479, 1497, 1506, 1519, 1531, 1543, 1556, 1567, 1578, 1589, 1604, 1614, 1630, 1641, 1651, 1662, 1675, 1688, 1700, 1711, 1721, 1732, 1748, 1758, 1772, 1784, 1795, 1806, 1820, 1830, 1844, 1855, 1866, 1877, 1892, 1902, 1914, 1926, 1939, 1950, 1965, 1974, 1986, 1999, 2011, 2023, 2037, 2047, 2059, 2072, 2084, 2096, 2107, 2120, 2132, 2144, 2156, 2169, 2180, 2191, 2202, 2217, 2227, 2239, 2251, 2264, 2275, 2286, 2297, 2309, 2321, 2332, 2347, 2358, 2369, 2381, 2394, 2406, 2417, 2429, 2439, 2452, 2465, 2476, 2490, 2501, 2512, 2524, 2536, 2546, 2560, 2570, 2581, 2593, 2605, 2616, 2628, 2640, 2653, 2664, 2676, 2688, 2700, 2712, 2723, 2735, 2748, 2759, 2772, 2784, 2795, 2808, 2820, 2831, 2842, 2854, 2866, 2878, 2888, 2901, 2913, 2927, 2936, 2947, 2958, 2970, 2982, 2994, 3005, 3019, 3030, 3041, 3053, 3064, 3077, 3088, 3099, 3110, 3123, 3135, 3146, 3157, 3168, 3179, 3192, 3203, 3214, 3226, 3238, 3251, 3263, 3275, 3286, 3297, 3308, 3320, 3331, 3344, 3356, 3368, 3380, 3391, 3402, 3415, 3426, 3440, 3451, 3462, 3474, 3485, 3496, 3508, 3520, 3532, 3543, 3556, 3569, 3580, 3593, 3604, 3615, 3626, 3638, 3650, 3661, 3673, 3684, 3698, 3709, 3721, 3732, 3744, 3756, 3767, 3779, 3792, 3803, 3814, 3827, 3838, 3850, 3862, 3873, 3885, 3897, 3909, 3920, 3932, 3943, 3955, 3966, 3980, 3990, 4002, 4014, 4026, 4038, 4050, 4061, 4072, 4083, 4095, 4107, 4119, 4131, 4143, 4156, 4167, 4179, 4191, 4203, 4215, 4227, 4238, 4252, 4262, 4274, 4287, 4298, 4310, 4321, 4333, 4345, 4356, 4370, 4381, 4393, 4406, 4417, 4428, 4440, 4453, 4464, 4477, 4489, 4500, 4513, 4524, 4536, 4548, 4560, 4573, 4583, 4595, 4607, 4620, 4631, 4645, 4655, 4667, 4679, 4690, 4702, 4714, 4728, 4739, 4750, 4762, 4774, 4786, 4798, 4810, 4821, 4833, 4845, 4857, 4869, 4880, 4892, 4905, 4916, 4927, 4940, 4952, 4963, 4977, 4988, 5000, 5012, 5023, 5034, 5045, 5057, 5069, 5081, 5093, 5104, 5115, 5127, 5139, 5151, 5163, 5176, 5188, 5199, 5211, 5223, 5235, 5247, 5259, 5272, 5283, 5296, 5308, 5320, 5331, 5343, 5354, 5366, 5378, 5390, 5402, 5414, 5426, 5438, 5450, 5462, 5474, 5486, 5497, 5510, 5521, 5532, 5544, 5557, 5569, 5581, 5592, 5604, 5617, 5629, 5641, 5652, 5663, 5676, 5687, 5699, 5712, 5724, 5735, 5748, 5760, 5771, 5784, 5794, 5806, 5817, 5829, 5841, 5853, 5866, 5879, 5891, 5903, 5916, 5928, 5941, 5952, 5964, 5976, 5988, 6000, 6012, 6024, 6036, 6048, 6060, 6072, 6085, 6096, 6109, 6121, 6133, 6146, 6157, 6168, 6180, 6192, 6203, 6215, 6227, 6239, 6251, 6265, 6276, 6289, 6302, 6313, 6325, 6337, 6349, 6361, 6374, 6386, 6398, 6410, 6422, 6436, 6448, 6459, 6471, 6483, 6495, 6507, 6520, 6532, 6545, 6555, 6567, 6579, 6591, 6603, 6615, 6627, 6640, 6652, 6664, 6676, 6688, 6700, 6713, 6726, 6738, 6749, 6761, 6774, 6786, 6799, 6811, 6823, 6835, 6848, 6859, 6871, 6883, 6895, 6907, 6920, 6933, 6945, 6956, 6968, 6980, 6992, 7005, 7016, 7030, 7042, 7053, 7066, 7079, 7091, 7104, 7115, 7128, 7140, 7152, 7163, 7175, 7187, 7200, 7212, 7224, 7235, 7248, 7260, 7272, 7285, 7297, 7309, 7321, 7333, 7345, 7358, 7370, 7382, 7394, 7406, 7419, 7431, 7443, 7455, 7468, 7480, 7492, 7505, 7517, 7530, 7542, 7554, 7566, 7578, 7591, 7603, 7615, 7628, 7640, 7653, 7666, 7677, 7690, 7702, 7714, 7727, 7738, 7750, 7762, 7775, 7786, 7799, 7812, 7823, 7836, 7848, 7859, 7871, 7884, 7896, 7909, 7921, 7933, 7946, 7958, 7971, 7984, 7996, 8007, 8019, 8032, 8044, 8056, 8069, 8081, 8094, 8107, 8119, 8131, 8143, 8155, 8167, 8179, 8192, 8205, 8218, 8230, 8244, 8255, 8267, 8279, 8291, 8303, 8315, 8328, 8340, 8353, 8366, 8378, 8392, 8404, 8417, 8431, 8443, 8455, 8467, 8479, 8492, 8504, 8516, 8529, 8543, 8555, 8567, 8580, 8593, 8606, 8619, 8632, 8644, 8658, 8670, 8683, 8695, 8708, 8721, 8733, 8746, 8759, 8771, 8783, 8795, 8808, 8821, 8833, 8845, 8858, 8871, 8885, 8898, 8910, 8923, 8936, 8949, 8960, 8973, 8986, 9000, 9012, 9025, 9038, 9051, 9064, 9076, 9089, 9102, 9114, 9126, 9139, 9151, 9164, 9177, 9191, 9204, 9217, 9230, 9243, 9255, 9268, 9281, 9294, 9307, 9320, 9333, 9345, 9358, 9371, 9384, 9398, 9412, 9424, 9437, 9450, 9462, 9475, 9488, 9501, 9514, 9528, 9542, 9554, 9567, 9581, 9593, 9606, 9619, 9632, 9645, 9658, 9671, 9682, 9695, 9708, 9721, 9735, 9749, 9762, 9776, 9789, 9802, 9815, 9828, 9842, 9855, 9867, 9880, 9893, 9906, 9920, 9933, 9947, 9960, 9974, 9987, 10000, 10014, 10027, 10040, 10054, 10067, 10081, 10095, 10107, 10120, 10134, 10148, 10161, 10175, 10188, 10201, 10214, 10228, 10241, 10254, 10267, 10280, 10294, 10309, 10322, 10335, 10348, 10362, 10374, 10387, 10401, 10415, 10428, 10441, 10455, 10469, 10482, 10497, 10510, 10523, 10537, 10551, 10565, 10579, 10593, 10606, 10621, 10634, 10647, 10661, 10675, 10689, 10704, 10719, 10732, 10746, 10760, 10774, 10788, 10802, 10815, 10829, 10843, 10856, 10871, 10884, 10898, 10913, 10927, 10940, 10955, 10970, 10984, 10999, 11013, 11027, 11042, 11056, 11071, 11086, 11100, 11114, 11128, 11142, 11158, 11171, 11186, 11200, 11213, 11228, 11241, 11255, 11270, 11284, 11299, 11314, 11328, 11342, 11356, 11370, 11385, 11399, 11413, 11429, 11445, 11460, 11474, 11489, 11503, 11518, 11533, 11549, 11563, 11577, 11592, 11607, 11621, 11637, 11651, 11665, 11680, 11694, 11708, 11725, 11740, 11754, 11768, 11784, 11798, 11813, 11828, 11843, 11858, 11874, 11888, 11904, 11920, 11933, 11948, 11964, 11979, 11993, 12009, 12024, 12041, 12058, 12071, 12087, 12102, 12117, 12132, 12148, 12165, 12179, 12195, 12210, 12226, 12241, 12256, 12273, 12288, 12304, 12320, 12335, 12350, 12365, 12382, 12398, 12414, 12430, 12446, 12462, 12478, 12495, 12511, 12525, 12541, 12556, 12575, 12591, 12605, 12622, 12638, 12653, 12671, 12686, 12705, 12721, 12739, 12756, 12772, 12788, 12806, 12822, 12839, 12855, 12873, 12890, 12908, 12923, 12941, 12960, 12975, 12992, 13009, 13024, 13040, 13059, 13076, 13092, 13109, 13128, 13145, 13161, 13179, 13194, 13216, 13233, 13249, 13266, 13287, 13303, 13322, 13337, 13357, 13375, 13392, 13410, 13424, 13446, 13465, 13480, 13499, 13517, 13533, 13559, 13575, 13595, 13612, 13632, 13650, 13670, 13687, 13706, 13726, 13744, 13765, 13783, 13803, 13822, 13841, 13860, 13879, 13897, 13917, 13936, 13960, 13979, 13996, 14019, 14040, 14057, 14077, 14102, 14122, 14141, 14163, 14184, 14202, 14225, 14244, 14265, 14287, 14312, 14336, 14356, 14375, 14393, 14420, 14438, 14465, 14483, 14500, 14536, 14555, 14575, 14604, 14619, 14648, 14668, 14691, 14725, 14748, 14770, 14788, 14818, 14840, 14862, 14888, 14921, 14939, 14969, 14996, 15022, 15051, 15075, 15098, 15130, 15149, 15167, 15218, 15237, 15276, 15297, 15333, 15356, 15379, 15418, 15447, 15481, 15508, 15530, 15574, 15599, 15643, 15680, 15697, 15743, 15759, 15775, 15813, 15845, 15877, 15911, 15931, 15968, 16014, 16049, 16077, 16088, 16138, 16149, 16185, 16200, 16241, 16280, 16296};
+
+ public ABITracerTest() {
+ }
+
+ @BeforeClass
+ public static void setUpClass() throws Exception {
+ }
+
+ @AfterClass
+ public static void tearDownClass() throws Exception {
+ }
+
+ @Before
+ public void setUp() {
+ }
+
+ @After
+ public void tearDown() {
+ }
+
+ /**
+ * Test of URL method, of class ABITracer.
+ */
+ @Test
+ public void testURL() throws Exception {
+ URL resource = this.getClass().getResource("/3730.ab1");
+ Assert.assertNotNull(resource);
+ ABITrace tracer = new ABITrace(resource);
+ Assert.assertNotNull(tracer);
+ }
+
+ /**
+ * Test of Local file method, of class ABITracer.
+ */
+ @Test
+ public void testLocal() throws Exception {
+ URL resource = this.getClass().getResource("/3730.ab1");
+ Assert.assertNotNull(resource);
+ File file = new File(resource.toURI());
+ Assert.assertNotNull(file);
+ ABITrace tracer = new ABITrace(file);
+ Assert.assertNotNull(tracer);
+
+ //Test length of tracer for file 3730.ab1
+ Assert.assertEquals(16302, tracer.getTraceLength());
+ //Test length of sequence for file 3730.ab1
+ Assert.assertEquals(1165, tracer.getSequenceLength());
+
+ //Test sequence of tracer for file 3730.ab1
+ Assert.assertTrue(sequence.equals(tracer.getSequence().getSequenceAsString()));
+ //Test array that represents the quality of tracer for file 3730.ab1
+ Assert.assertArrayEquals(qual, tracer.getQcalls());
+ //Test array that represents the baseline of tracer for file 3730.ab1
+ Assert.assertArrayEquals(base, tracer.getBasecalls());
+ //Test image of tracer for file 3730.ab1
+ BufferedImage image = tracer.getImage(100,100);
+ Assert.assertNotNull(image);
+ }
+}
diff --git a/biojava-core/src/test/resources/3730.ab1 b/biojava-core/src/test/resources/3730.ab1
new file mode 100644
index 0000000000..6c2c6c43b9
Binary files /dev/null and b/biojava-core/src/test/resources/3730.ab1 differ
diff --git a/biojava-genome/pom.xml b/biojava-genome/pom.xml
index aa1f0f578e..8c290fb3ce 100644
--- a/biojava-genome/pom.xml
+++ b/biojava-genome/pom.xml
@@ -3,7 +3,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
4.0.0
biojava-genome
@@ -85,13 +85,13 @@
org.biojava
biojava-core
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
org.biojava
biojava-alignment
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
diff --git a/biojava-integrationtest/pom.xml b/biojava-integrationtest/pom.xml
index 05db6cf131..cd9ce7282e 100644
--- a/biojava-integrationtest/pom.xml
+++ b/biojava-integrationtest/pom.xml
@@ -4,7 +4,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-integrationtest
jar
@@ -28,7 +28,7 @@
org.biojava
biojava-structure
- 5.0.2-SNAPSHOT
+ 5.1.0
diff --git a/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java b/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java
index c324a421bf..a18d453d7d 100644
--- a/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java
+++ b/biojava-integrationtest/src/test/java/org/biojava/nbio/structure/test/io/TestBioassemblies.java
@@ -145,12 +145,11 @@ public void test4OPJ() throws IOException, StructureException {
assertEquals(3, multiModelBioAssemblies.get(0).getPolyChains(0).size() + multiModelBioAssemblies.get(0).getPolyChains(1).size());
// 3 chains in flattened structure in bioassembly 1
assertEquals(3, flattenedBioAssemblies.get(0).getPolyChains().size());
-
+
// 3 chains divided into 2 models in bioassembly 2
- assertEquals(3, multiModelBioAssemblies.get(1).getPolyChains(0).size() + multiModelBioAssemblies.get(0).getPolyChains(1).size());
+ assertEquals(3, multiModelBioAssemblies.get(1).getPolyChains(0).size() + multiModelBioAssemblies.get(1).getPolyChains(1).size());
// 3 chains in flattened structure in bioassembly 2
assertEquals(3, flattenedBioAssemblies.get(1).getPolyChains().size());
-
// chain ids and names don't contain underscores in multimodel
for (int modelIdx = 0; modelIdx
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-modfinder
biojava-modfinder
@@ -31,7 +31,7 @@
org.biojava
biojava-structure
- 5.0.2-SNAPSHOT
+ 5.1.0
jar
compile
diff --git a/biojava-ontology/pom.xml b/biojava-ontology/pom.xml
index fcf5b5e34f..41cfe229df 100644
--- a/biojava-ontology/pom.xml
+++ b/biojava-ontology/pom.xml
@@ -4,7 +4,7 @@
org.biojava
biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-ontology
diff --git a/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java b/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java
index 88f78016f2..49e3c2b56c 100644
--- a/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java
+++ b/biojava-ontology/src/main/java/org/biojava/nbio/ontology/obo/OboFileHandler.java
@@ -66,6 +66,7 @@ public class OboFileHandler implements OboFileEventListener {
public static final String SUBSET = "subset";
public static final String INTERSECTION_OF = "intersection_of";
public static final String NAMESPACE = "namespace";
+ public static final String REPLACED_BY = "replaced_by";
public static final String ALT_ID = "alt_id";
@@ -135,6 +136,10 @@ public void newKey(String key, String value) {
logger.warn("did not find ID for Term! ");
return;
}
+ if (key.equals(NAMESPACE)){
+ Annotation anno = currentTerm.getAnnotation();
+ anno.setProperty(NAMESPACE, value);
+ }
else if (key.equals(NAME)){
currentTerm.setDescription(value);
} else if (key.equals(DEF)){
@@ -172,10 +177,10 @@ else if (key.equals(NAME)){
Annotation anno = currentTerm.getAnnotation();
anno.setProperty(ALT_ID, value);
}
- else if (key.equals(NAMESPACE)){
- Annotation anno = currentTerm.getAnnotation();
- anno.setProperty(NAMESPACE, value);
- }
+ else if (key.equals(REPLACED_BY)) {
+ Annotation anno = currentTerm.getAnnotation();
+ anno.setProperty(REPLACED_BY, value);
+ }
else {
//logger.info("unknown key {}", key);
@@ -195,4 +200,4 @@ public void newSynonym(Synonym synonym) {
}
}
-}
+}
\ No newline at end of file
diff --git a/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java b/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java
index f519e6b483..16af1a4fce 100644
--- a/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java
+++ b/biojava-ontology/src/test/java/org/biojava/nbio/ontology/TestOboFileParsing.java
@@ -34,6 +34,8 @@
import java.io.InputStream;
import java.io.InputStreamReader;
import java.util.Set;
+import java.util.Iterator;
+import org.biojava.nbio.ontology.utils.Annotation;
public class TestOboFileParsing {
@@ -56,4 +58,29 @@ public void testParsingBioSapiensOBO() throws Exception {
Assert.assertTrue(keys.size() > 4000);
}
+ @Test
+ public void testParsingHPOOBO() throws Exception {
+ OboParser parser = new OboParser();
+ InputStream inStream = parser.getClass().getResourceAsStream("/ontology/hp.obo");
+
+ Assert.assertNotNull(inStream);
+
+ BufferedReader oboFile = new BufferedReader ( new InputStreamReader ( inStream ) );
+
+ Ontology ontology;
+
+ ontology = parser.parseOBO(oboFile, "Human_phenotype", "the Human Phenotype ontology");
+ Set keys = ontology.getTerms();
+ Iterator iter = keys.iterator();
+
+ while (iter.hasNext()){
+ Term term = (Term) iter.next();
+ if(term.getName().equals("HP:0000057")) {
+ Annotation anno = term.getAnnotation();
+ Assert.assertTrue(anno.containsProperty("replaced_by"));
+ Assert.assertEquals("HP:0008665", anno.getProperty("replaced_by"));
+ }
+ }
+ }
+
}
diff --git a/biojava-ontology/src/test/resources/ontology/hp.obo b/biojava-ontology/src/test/resources/ontology/hp.obo
new file mode 100644
index 0000000000..47881d7819
--- /dev/null
+++ b/biojava-ontology/src/test/resources/ontology/hp.obo
@@ -0,0 +1,574 @@
+format-version: 1.2
+data-version: releases/2018-03-08
+saved-by: Peter Robinson, Sebastian Koehler, Sandra Doelken, Chris Mungall, Melissa Haendel, Nicole Vasilevsky, Monarch Initiative, et al.
+subsetdef: hposlim_core "Core clinical terminology"
+subsetdef: secondary_consequence "Consequence of a disorder in another organ system."
+synonymtypedef: HP:0045076 "UK spelling"
+synonymtypedef: HP:0045077 "abbreviation"
+synonymtypedef: HP:0045078 "plural form"
+synonymtypedef: layperson "layperson term"
+default-namespace: human_phenotype
+ontology: hp
+property_value: http://purl.org/dc/elements/1.1/contributor "Chris Mungall" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Courtney Hum" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Joie Davis" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Mark Engelstad" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Melissa Haendel" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Nicole Vasilevsky" xsd:string
+property_value: http://purl.org/dc/elements/1.1/contributor "Sandra Doelken" xsd:string
+property_value: http://purl.org/dc/elements/1.1/creator "Peter N Robinson" xsd:string
+property_value: http://purl.org/dc/elements/1.1/creator "Sebastian Koehler" xsd:string
+property_value: http://purl.org/dc/elements/1.1/creator "The Human Phenotype Ontology Consortium" xsd:string
+property_value: http://purl.org/dc/elements/1.1/creator "The Monarch Initiative" xsd:string
+property_value: http://purl.org/dc/elements/1.1/license "see http://www.human-phenotype-ontology.org" xsd:string
+property_value: http://purl.org/dc/elements/1.1/rights "Peter Robinson, Sebastian Koehler, The Human Phenotype Ontology Consortium, and The Monarch Initiative" xsd:string
+property_value: http://purl.org/dc/elements/1.1/subject "Phenotypic abnormalities encountered in human disease" xsd:string
+owl-axioms: Prefix(owl:=)\nPrefix(rdf:=)\nPrefix(xml:=)\nPrefix(xsd:=)\nPrefix(rdfs:=)\n\n\nOntology(\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion( \"\")\nAnnotationAssertion(rdfs:comment \"\")\nAnnotationAssertion( \"\"^^xsd:string)\n)
+logical-definition-view-relation: has_part
+
+[Term]
+id: HP:0000001
+name: All
+comment: Root of all terms in the Human Phenotype Ontology.
+xref: UMLS:C0444868
+
+[Term]
+id: HP:0000002
+name: Abnormality of body height
+def: "Deviation from the norm of height with respect to that which is expected according to age and gender norms." [HPO:probinson]
+synonym: "Abnormality of body height" EXACT layperson []
+xref: UMLS:C4025901
+is_a: HP:0001507 ! Growth abnormality
+created_by: peter
+creation_date: 2008-02-27T02:20:00Z
+
+[Term]
+id: HP:0000003
+name: Multicystic kidney dysplasia
+alt_id: HP:0004715
+def: "Multicystic dysplasia of the kidney is characterized by multiple cysts of varying size in the kidney and the absence of a normal pelvicaliceal system. The condition is associated with ureteral or ureteropelvic atresia, and the affected kidney is nonfunctional." [HPO:curators]
+comment: Multicystic kidney dysplasia is the result of abnormal fetal renal development in which the affected kidney is replaced by multiple cysts and has little or no residual function. The vast majority of multicystic kidneys are unilateral. Multicystic kidney can be diagnosed on prenatal ultrasound.
+synonym: "Multicystic dysplastic kidney" EXACT []
+synonym: "Multicystic kidneys" EXACT []
+synonym: "Multicystic renal dysplasia" EXACT []
+xref: MSH:D021782
+xref: SNOMEDCT_US:204962002
+xref: SNOMEDCT_US:82525005
+xref: UMLS:C3714581
+is_a: HP:0000107 ! Renal cyst
+
+[Term]
+id: HP:0000005
+name: Mode of inheritance
+alt_id: HP:0001453
+alt_id: HP:0001461
+def: "The pattern in which a particular genetic trait or disorder is passed from one generation to the next." [HPO:probinson]
+synonym: "Inheritance" EXACT []
+xref: UMLS:C1708511
+is_a: HP:0000001 ! All
+
+[Term]
+id: HP:0000006
+name: Autosomal dominant inheritance
+alt_id: HP:0001415
+alt_id: HP:0001447
+alt_id: HP:0001448
+alt_id: HP:0001451
+alt_id: HP:0001455
+alt_id: HP:0001456
+alt_id: HP:0001463
+def: "A mode of inheritance that is observed for traits related to a gene encoded on one of the autosomes (i.e., the human chromosomes 1-22) in which a trait manifests in heterozygotes. In the context of medical genetics, an autosomal dominant disorder is caused when a single copy of the mutant allele is present. Males and females are affected equally, and can both transmit the disorder with a risk of 50% for each child of inheriting the mutant allele." [HPO:curators]
+synonym: "Autosomal dominant" EXACT []
+synonym: "Autosomal dominant form" RELATED [HPO:skoehler]
+synonym: "Autosomal dominant type" RELATED [HPO:skoehler]
+xref: SNOMEDCT_US:263681008
+xref: UMLS:C0443147
+is_a: HP:0000005 ! Mode of inheritance
+
+[Term]
+id: HP:0000007
+name: Autosomal recessive inheritance
+alt_id: HP:0001416
+alt_id: HP:0001526
+def: "A mode of inheritance that is observed for traits related to a gene encoded on one of the autosomes (i.e., the human chromosomes 1-22) in which a trait manifests in homozygotes. In the context of medical genetics, autosomal recessive disorders manifest in homozygotes (with two copies of the mutant allele) or compound heterozygotes (whereby each copy of a gene has a distinct mutant allele)." [HPO:curators]
+synonym: "Autosomal recessive" EXACT []
+synonym: "Autosomal recessive form" RELATED [HPO:skoehler]
+synonym: "Autosomal recessive predisposition" RELATED []
+xref: SNOMEDCT_US:258211005
+xref: UMLS:C0441748
+xref: UMLS:C4020899
+is_a: HP:0000005 ! Mode of inheritance
+
+[Term]
+id: HP:0000008
+name: Abnormality of female internal genitalia
+def: "An abnormality of the female internal genitalia." [HPO:probinson]
+xref: UMLS:C4025900
+is_a: HP:0000812 ! Abnormal internal genitalia
+is_a: HP:0010460 ! Abnormality of the female genitalia
+
+[Term]
+id: HP:0000009
+name: Functional abnormality of the bladder
+alt_id: HP:0004424
+alt_id: HP:0008731
+def: "Dysfunction of the urinary bladder." [HPO:probinson]
+synonym: "Poor bladder function" EXACT []
+xref: UMLS:C3806583
+is_a: HP:0000014 ! Abnormality of the bladder
+
+[Term]
+id: HP:0000010
+name: Recurrent urinary tract infections
+alt_id: HP:0000094
+def: "Repeated infections of the urinary tract." [HPO:probinson]
+comment: The urinary tract comprises the kidneys, ureters, a bladder, and a urethra.
+synonym: "Frequent urinary tract infections" EXACT layperson []
+synonym: "Urinary infection" EXACT layperson []
+synonym: "Urinary tract infection" EXACT layperson []
+synonym: "Urinary tract infections" EXACT layperson []
+synonym: "Urinary tract infections, recurrent" EXACT layperson [HPO:skoehler]
+xref: SNOMEDCT_US:197927001
+xref: UMLS:C0262655
+is_a: HP:0002719 ! Recurrent infections
+is_a: HP:0011277 ! Abnormality of the urinary system physiology
+
+[Term]
+id: HP:0000011
+name: Neurogenic bladder
+def: "An inability to completely empty the urinary bladder during the process of urination owing to a neurological condition." [HPO:probinson]
+xref: MSH:D001750
+xref: SNOMEDCT_US:397732007
+xref: SNOMEDCT_US:398064005
+xref: UMLS:C0005697
+is_a: HP:0000009 ! Functional abnormality of the bladder
+
+[Term]
+id: HP:0000012
+name: Urinary urgency
+def: "Urge incontinence is the strong, sudden need to urinate." [HPO:probinson, pmid:12559262]
+comment: Urinary urgency is the strong, sudden need to urinate and is usually due to bladder spasms or contractions. This symptom is suggestive of, but not necessarily conclusive for urodynamically demonstrable detrusor hyperactivity.
+synonym: "Overactive bladder" EXACT layperson [ORCID:0000-0002-0736-9199]
+synonym: "Overactive bladder syndrome" RELATED []
+synonym: "Urgency frequency syndrome" RELATED []
+synonym: "Urinary urgency" EXACT layperson []
+xref: SNOMEDCT_US:75088002
+xref: UMLS:C0085606
+xref: UMLS:C3544092
+xref: UMLS:C4020898
+is_a: HP:0000009 ! Functional abnormality of the bladder
+
+[Term]
+id: HP:0000013
+name: Hypoplasia of the uterus
+alt_id: HP:0001154
+alt_id: HP:0008637
+def: "Underdevelopment of the uterus." [HPO:probinson]
+synonym: "Hypoplastic uterus" EXACT []
+synonym: "Rudimentary uterus" EXACT []
+synonym: "Small uterus" EXACT layperson [ORCID:0000-0001-5208-3432]
+synonym: "Underdeveloped uterus" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: SNOMEDCT_US:35850006
+xref: UMLS:C0266399
+is_a: HP:0008684 ! Aplasia/hypoplasia of the uterus
+
+[Term]
+id: HP:0000014
+name: Abnormality of the bladder
+def: "An abnormality of the urinary bladder." [HPO:probinson]
+xref: UMLS:C0149632
+is_a: HP:0010936 ! Abnormality of the lower urinary tract
+
+[Term]
+id: HP:0000015
+name: Bladder diverticulum
+def: "Diverticulum (sac or pouch) in the wall of the urinary bladder." [HPO:probinson]
+synonym: "Bladder diverticula" EXACT [HPO:skoehler]
+xref: MSH:C562406
+xref: SNOMEDCT_US:197866008
+xref: UMLS:C0156273
+is_a: HP:0025487 ! Abnormality of bladder morphology
+
+[Term]
+id: HP:0000016
+name: Urinary retention
+def: "Inability to completely empty the urinary bladder during the process of urination." [HPO:probinson]
+comment: Urinary retention is the inability of the urinary bladder to empty. The cause may be neurologic or nonneurologic.
+synonym: "Increased post-void residual urine volume" EXACT []
+xref: MSH:D016055
+xref: SNOMEDCT_US:130951007
+xref: SNOMEDCT_US:267064002
+xref: SNOMEDCT_US:449491000124101
+xref: UMLS:C0080274
+is_a: HP:0000009 ! Functional abnormality of the bladder
+
+[Term]
+id: HP:0000017
+name: Nocturia
+def: "Abnormally increased production of urine during the night leading to an unusually frequent need to urinate." [HPO:sdoelken]
+comment: Often occuring as a result of heart insufficiency.
+synonym: "Nycturia" EXACT [HPO:sdoelken]
+xref: MSH:D053158
+xref: SNOMEDCT_US:139394000
+xref: UMLS:C0028734
+is_a: HP:0000009 ! Functional abnormality of the bladder
+
+[Term]
+id: HP:0000019
+name: Urinary hesitancy
+def: "Difficulty in beginning the process of urination." [HPO:probinson]
+synonym: "Difficulty with flow" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: SNOMEDCT_US:5972002
+xref: UMLS:C0152032
+is_a: HP:0000009 ! Functional abnormality of the bladder
+
+[Term]
+id: HP:0000020
+name: Urinary incontinence
+alt_id: HP:0006942
+alt_id: HP:0008681
+def: "Loss of the ability to control the urinary bladder leading to involuntary urination." [HPO:sdoelken, pmid:12559262]
+comment: Urinary incontinence can be defined as the complaint of any involuntary leakage of urine.
+synonym: "Bladder incontinence" EXACT []
+synonym: "Loss of bladder control" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: MSH:D014549
+xref: SNOMEDCT_US:165232002
+xref: UMLS:C0042024
+is_a: HP:0000009 ! Functional abnormality of the bladder
+is_a: HP:0031064 ! Impaired continence
+
+[Term]
+id: HP:0000021
+name: Megacystis
+alt_id: HP:0002838
+def: "Dilatation of the bladder postnatally." [HPO:probinson]
+xref: MSH:C536139
+xref: UMLS:C1855311
+is_a: HP:0010955 ! Dilatation of the bladder
+
+[Term]
+id: HP:0000022
+name: Abnormality of male internal genitalia
+def: "An abnormality of the male internal genitalia." [HPO:probinson]
+comment: The internal genital structures of the male including the testis, epididymis, vas deferens, seminal vesicle, ejaculatory duct, bulbourethral gland, and the prostate.
+xref: UMLS:C4025899
+is_a: HP:0000812 ! Abnormal internal genitalia
+is_a: HP:0010461 ! Abnormality of the male genitalia
+
+[Term]
+id: HP:0000023
+name: Inguinal hernia
+def: "Protrusion of the contents of the abdominal cavity through the inguinal canal." [HPO:probinson]
+comment: Inguinal hernia appears as a bulge in the groin.
+subset: hposlim_core
+xref: MEDDRA:10022016 "Inguinal hernia"
+xref: MSH:D006552
+xref: SNOMEDCT_US:396232000
+xref: UMLS:C0019294
+is_a: HP:0004299 ! Hernia of the abdominal wall
+
+[Term]
+id: HP:0000024
+name: Prostatitis
+def: "The presence of inflammation of the prostate." [HPO:probinson]
+synonym: "Inflammation of the prostate" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: MSH:D011472
+xref: SNOMEDCT_US:9713002
+xref: UMLS:C0033581
+is_a: HP:0008775 ! Abnormality of the prostate
+is_a: HP:0012649 ! Increased inflammatory response
+
+[Term]
+id: HP:0000025
+name: Functional abnormality of male internal genitalia
+xref: UMLS:C4025898
+is_a: HP:0012874 ! Abnormal male reproductive system physiology
+
+[Term]
+id: HP:0000026
+name: Male hypogonadism
+alt_id: HP:0008649
+def: "Decreased functionality of the male gonad, i.e., of the testis, with reduced spermatogenesis or testosterone synthesis." [HPO:probinson]
+synonym: "Decreased function of male gonad" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: MSH:D005058
+xref: SNOMEDCT_US:48723006
+xref: UMLS:C0151721
+is_a: HP:0000025 ! Functional abnormality of male internal genitalia
+is_a: HP:0000135 ! Hypogonadism
+
+[Term]
+id: HP:0000027
+name: Azoospermia
+def: "Absence of any measurable level of sperm in his semen." [HPO:probinson, pmid:20514278]
+synonym: "Absent sperm in semen" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: MSH:D053713
+xref: SNOMEDCT_US:425558002
+xref: SNOMEDCT_US:48188009
+xref: UMLS:C0004509
+is_a: HP:0008669 ! Abnormal spermatogenesis
+
+[Term]
+id: HP:0000028
+name: Cryptorchidism
+alt_id: HP:0000797
+def: "Testis in inguinal canal. That is, absence of one or both testes from the scrotum owing to failure of the testis or testes to descend through the inguinal canal to the testis." [HPO:probinson, pmid:23650202]
+comment: The gonad is mobile and can be retracted superiorly by the cremaster muscle reflex stimulated, for instance, by cold or touch. A retracted testis is not cryptorchidism. An abdominal testis cannot be distinguished by physical examination from an (Apparently) absent testis and requires radiological (or, rarely, surgical) procedures for assessment.
+synonym: "Cryptorchism" EXACT [ORCID:0000-0001-5208-3432]
+synonym: "Undescended testes" EXACT layperson []
+synonym: "Undescended testis" EXACT layperson []
+xref: Fyler:4493
+xref: MSH:D003456
+xref: SNOMEDCT_US:204878001
+xref: UMLS:C0010417
+is_a: HP:0000035 ! Abnormality of the testis
+
+[Term]
+id: HP:0000029
+name: Testicular atrophy
+def: "Wasting (atrophy) of the testicle (the male gonad) manifested by a decrease in size and potentially by a loss of fertility." [HPO:probinson]
+synonym: "Testicular degeneration" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: SNOMEDCT_US:17585008
+xref: UMLS:C0156312
+is_a: HP:0000035 ! Abnormality of the testis
+
+[Term]
+id: HP:0000030
+name: Testicular gonadoblastoma
+def: "The presence of a gonadoblastoma of the testis." [HPO:probinson]
+synonym: "Gonadoblastoma, male" RELATED []
+xref: UMLS:C1515283
+is_a: HP:0000150 ! Gonadoblastoma
+is_a: HP:0010788 ! Testicular neoplasm
+
+[Term]
+id: HP:0000031
+name: Epididymitis
+def: "The presence of inflammation of the epididymis." [HPO:probinson]
+xref: MSH:D004823
+xref: SNOMEDCT_US:31070006
+xref: UMLS:C0014534
+is_a: HP:0009714 ! Abnormality of the epididymis
+is_a: HP:0012649 ! Increased inflammatory response
+
+[Term]
+id: HP:0000032
+name: Abnormality of male external genitalia
+def: "An abnormality of male external genitalia." [HPO:probinson]
+xref: UMLS:C4025897
+is_a: HP:0000811 ! Abnormal external genitalia
+is_a: HP:0010461 ! Abnormality of the male genitalia
+
+[Term]
+id: HP:0000033
+name: Ambiguous genitalia, male
+def: "Ambiguous genitalia in an individual with XY genetic gender." [HPO:probinson]
+synonym: "Ambiguous genitalia in males" EXACT layperson []
+xref: UMLS:C4021823
+is_a: HP:0000032 ! Abnormality of male external genitalia
+is_a: HP:0000062 ! Ambiguous genitalia
+
+[Term]
+id: HP:0000034
+name: Hydrocele testis
+def: "Accumulation of clear fluid in the between the layers of membrane (tunica vaginalis) surrounding the testis." [HPO:probinson]
+synonym: "Hydrocele" BROAD []
+synonym: "Testicular hydrocele" EXACT []
+xref: MSH:D006848
+xref: SNOMEDCT_US:26614003
+xref: SNOMEDCT_US:386152007
+xref: SNOMEDCT_US:55434001
+xref: UMLS:C1720771
+is_a: HP:0000035 ! Abnormality of the testis
+
+[Term]
+id: HP:0000035
+name: Abnormality of the testis
+def: "An anomaly of the testicle (the male gonad)." [HPO:probinson]
+synonym: "Abnormality of the testis" EXACT layperson []
+synonym: "Anomaly of the testes" EXACT []
+xref: SNOMEDCT_US:55631001
+xref: UMLS:C0266423
+is_a: HP:0000032 ! Abnormality of male external genitalia
+
+[Term]
+id: HP:0000036
+name: Abnormality of the penis
+synonym: "Abnormality of the penis" EXACT layperson []
+xref: UMLS:C4025896
+is_a: HP:0000032 ! Abnormality of male external genitalia
+
+[Term]
+id: HP:0000037
+name: Male pseudohermaphroditism
+def: "Hermaphroditism refers to a discrepancy between the morphology of the gonads and that of the external genitalia. In male pseudohermaphroditism, the genotype is male (XY) and the external genitalia are imcompletely virilized, ambiguous, or complete female. If gonads are present, they are testes." [HPO:curators]
+xref: MSH:D058490
+xref: SNOMEDCT_US:111332007
+xref: UMLS:C0238395
+is_a: HP:0000032 ! Abnormality of male external genitalia
+
+[Term]
+id: HP:0000039
+name: Epispadias
+def: "Displacement of the urethral opening on the dorsal (superior) surface of the penis." [HPO:probinson, pmid:23650202]
+comment: Epispadias may be present in a phenotypic male, female, or an individual with ambiguous genitalia. A meatus in a phenotypic male may be positioned either on the glans (glandular or balanic epispadias), the shaft (penile epispadias) or at the attachment of the penis to the abdominal wall (penopubic epispadias). Alternatively, the urethra may be an open groove along the dorsal shaft of the penis, with no readily recognized meatus. Epispadias is a frequent component of Bladder exstrophy, but should be coded separately.
+xref: SNOMEDCT_US:406477003
+xref: UMLS:C0563449
+is_a: HP:0100627 ! Displacement of the external urethral meatus
+
+[Term]
+id: HP:0000040
+name: Long penis
+def: "Penile length more than 2 SD above the mean for age." []
+comment: Penile length is the distance between the midline attachment of the gently stretched, flaccid penis above the pubic symphysis and tip of the glans.
+synonym: "Enlarged penis" EXACT layperson []
+synonym: "Long penis" EXACT layperson []
+xref: SNOMEDCT_US:88673001
+xref: UMLS:C0269011
+is_a: HP:0000036 ! Abnormality of the penis
+
+[Term]
+id: HP:0000041
+name: Chordee
+def: "Ventral, lateral, or ventrolateral bowing of the shaft and glans penis of more than 30 degrees." [HPO:probinson, pmid:23650202]
+comment: The degree of variation of penis curvature is a continuum, but traditionally 30 degrees is considered the threshold for surgical intervention on chordee. Bowing usually becomes more obvious in an erect penis, but is frequently also palpable when stretching a flaccid penis. Chordee can be congenital or acquired; if the former, it can be associated with Webbed Penis or Hypospadias, which should be coded separately.
+xref: SNOMEDCT_US:4287008
+xref: UMLS:C0221182
+is_a: HP:0000036 ! Abnormality of the penis
+
+[Term]
+id: HP:0000042
+name: Absent external genitalia
+def: "Lack of external genitalia in a male or female individual." [HPO:probinson]
+synonym: "Absent external genitalia" EXACT layperson []
+xref: UMLS:C1848869
+is_a: HP:0000811 ! Abnormal external genitalia
+
+[Term]
+id: HP:0000044
+name: Hypogonadotrophic hypogonadism
+alt_id: HP:0003335
+alt_id: HP:0008224
+def: "Hypogonadotropic hypogonadism is characterized by reduced function of the gonads (testes in males or ovaries in females) and results from the absence of the gonadal stimulating pituitary hormones: follicle stimulating hormone (FSH) and luteinizing hormone (LH)." [HPO:probinson]
+synonym: "Hypogonadism, hypogonadotropic" EXACT []
+synonym: "Isolated hypogonadotropic hypogonadism" RELATED []
+synonym: "Low gonadotropins (secondary hypogonadism)" EXACT []
+xref: MSH:D007006
+xref: SNOMEDCT_US:33927004
+xref: UMLS:C0271623
+xref: UMLS:C3489396
+is_a: HP:0000135 ! Hypogonadism
+
+[Term]
+id: HP:0000045
+name: Abnormality of the scrotum
+xref: UMLS:C4025895
+is_a: HP:0000032 ! Abnormality of male external genitalia
+
+[Term]
+id: HP:0000046
+name: Scrotal hypoplasia
+synonym: "Hypoplastic scrotum" EXACT []
+xref: SNOMEDCT_US:204912007
+xref: UMLS:C0431659
+is_a: HP:0000045 ! Abnormality of the scrotum
+is_a: HP:0000050 ! Hypoplastic male external genitalia
+
+[Term]
+id: HP:0000047
+name: Hypospadias
+def: "Abnormal position of urethral meatus on the ventral penile shaft (underside) characterized by displacement of the urethral meatus from the tip of the glans penis to the ventral surface of the penis, scrotum, or perineum." [HPO:probinson, PMID:21968448]
+synonym: "Hypospadia" EXACT [ORCID:0000-0001-5208-3432]
+xref: Fyler:4504
+xref: SNOMEDCT_US:204888000
+xref: UMLS:C1691215
+is_a: HP:0100627 ! Displacement of the external urethral meatus
+
+[Term]
+id: HP:0000048
+name: Bifid scrotum
+def: "Midline indentation or cleft of the scrotum." [HPO:probinson, pmid:23650202]
+comment: A testis may or may not be present in each half of the scrotum.
+synonym: "Cleft of scrotum" EXACT layperson [ORCID:0000-0001-5208-3432]
+synonym: "Scrotal cleft" EXACT []
+xref: SNOMEDCT_US:236780002
+xref: UMLS:C0341787
+is_a: HP:0000045 ! Abnormality of the scrotum
+
+[Term]
+id: HP:0000049
+name: Shawl scrotum
+def: "Superior margin of the scrotum superior to the base of the penis." [HPO:probinson, pmid:23650202]
+comment: A congenital overriding scrotum may disappear with growth and development, especially during puberty. If the entire scrotum is located superior to the penis, the term Penoscrotal transposition is used instead.
+synonym: "Overriding scrotum" EXACT []
+xref: UMLS:C1858539
+is_a: HP:0000045 ! Abnormality of the scrotum
+
+[Term]
+id: HP:0000050
+name: Hypoplastic male external genitalia
+alt_id: HP:0008710
+alt_id: HP:0008721
+def: "Underdevelopment of part or all of the male external reproductive organs (which include the penis, the scrotum and the urethra)." [HPO:probinson]
+synonym: "Hypoplastic male genitalia" EXACT []
+synonym: "Small male external genitalia" EXACT layperson []
+synonym: "Underdeveloped male genitalia" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: UMLS:C1852534
+is_a: HP:0003241 ! External genital hypoplasia
+
+[Term]
+id: HP:0000051
+name: Perineal hypospadias
+def: "Hypospadias with location of the urethral meatus in the perineal region." [HPO:probinson, pmid:8097257]
+xref: SNOMEDCT_US:204890004
+xref: UMLS:C0452148
+is_a: HP:0000047 ! Hypospadias
+
+[Term]
+id: HP:0000052
+name: Urethral atresia, male
+def: "Congenital anomaly characterized by closure or failure to develop an opening in the urethra in males." [HPO:probinson]
+xref: UMLS:C4025894
+is_a: HP:0000068 ! Urethral atresia
+
+[Term]
+id: HP:0000053
+name: Macroorchidism
+def: "The presence of abnormally large testes." [HPO:probinson]
+synonym: "Large testicles" EXACT []
+synonym: "Large testis" EXACT layperson []
+xref: UMLS:C1263023
+is_a: HP:0045058 ! Abnormality of the testis size
+
+[Term]
+id: HP:0000054
+name: Micropenis
+alt_id: HP:0000038
+def: "Abnormally small penis. At birth, the normal penis is about 3 cm (stretched length from pubic tubercle to tip of penis) with micropenis less than 2.0-2.5 cm." [HPO:probinson, pmid:15102623]
+synonym: "Short penis" EXACT layperson []
+synonym: "Small penis" EXACT layperson []
+xref: SNOMEDCT_US:34911001
+xref: UMLS:C0266435
+is_a: HP:0008736 ! Hypoplasia of penis
+
+[Term]
+id: HP:0000055
+name: Abnormality of female external genitalia
+def: "An abnormality of the female external genitalia." [HPO:probinson]
+synonym: "Abnormal female external genitalia" EXACT layperson [HPO:skoehler]
+xref: UMLS:C4021822
+is_a: HP:0000811 ! Abnormal external genitalia
+is_a: HP:0010460 ! Abnormality of the female genitalia
+
+[Term]
+id: HP:0000056
+name: Abnormality of the clitoris
+def: "An abnormality of the clitoris." [HPO:probinson]
+synonym: "Abnormality of the clit" EXACT layperson [ORCID:0000-0001-5208-3432]
+xref: UMLS:C4025893
+is_a: HP:0000055 ! Abnormality of female external genitalia
+
+[Term]
+id: HP:0000057
+name: obsolete Clitoromegaly
+is_obsolete: true
+replaced_by: HP:0008665
\ No newline at end of file
diff --git a/biojava-protein-disorder/pom.xml b/biojava-protein-disorder/pom.xml
index 3307d8130c..ca7c3130a5 100644
--- a/biojava-protein-disorder/pom.xml
+++ b/biojava-protein-disorder/pom.xml
@@ -3,7 +3,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-protein-disorder
jar
@@ -63,7 +63,7 @@
org.biojava
biojava-core
- 5.0.2-SNAPSHOT
+ 5.1.0
diff --git a/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java b/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java
index c6ade3dfef..d3c50fd61b 100644
--- a/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java
+++ b/biojava-protein-disorder/src/test/java/org/biojava/nbio/ronn/NonstandardProteinCompoundTest.java
@@ -84,7 +84,8 @@ private void testUniprot(String uniprotID) throws CompoundNotFoundException, IOE
}
- /** Fetch a protein sequence from the UniProt web site
+ /**
+ * Fetch a protein sequence from the UniProt web site
*
* @param uniProtID
* @return a Protein Sequence
diff --git a/biojava-structure-gui/pom.xml b/biojava-structure-gui/pom.xml
index 490b31b1d2..7f0e8d9eac 100644
--- a/biojava-structure-gui/pom.xml
+++ b/biojava-structure-gui/pom.xml
@@ -3,7 +3,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
4.0.0
biojava-structure-gui
@@ -27,13 +27,13 @@
org.biojava
biojava-structure
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
org.biojava
biojava-core
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
@@ -42,7 +42,7 @@
net.sourceforge.jmol
jmol
- 14.6.2_2016.08.28
+ 14.29.17
diff --git a/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java b/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java
index 232b37d295..2aab5fc80c 100644
--- a/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java
+++ b/biojava-structure-gui/src/main/java/org/biojava/nbio/structure/align/gui/jmol/JmolPanel.java
@@ -126,30 +126,44 @@ public JmolStatusListener getStatusListener(){
public void executeCmd(String rasmolScript) {
viewer.evalString(rasmolScript);
}
-
- public void setStructure(final Structure s)
- {
+
+ public void setStructure(final Structure s, boolean useMmtf) {
+
this.structure = s;
- try (
- PipedOutputStream out = new PipedOutputStream();
- // Viewer requires a BufferedInputStream for reflection
- InputStream in = new BufferedInputStream(new PipedInputStream(out));
- ) {
- new Thread((Runnable)() -> {
- try {
- MmtfActions.writeToOutputStream(s,out);
- } catch (Exception e) {
- logger.error("Error generating MMTF output for {}",
- s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e);
- }
- }).start();
- viewer.openReader(null, in);
- } catch (IOException e) {
- logger.error("Error transfering {} to Jmol",
- s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e);
+
+ if (useMmtf) {
+ try (
+ PipedOutputStream out = new PipedOutputStream();
+ // Viewer requires a BufferedInputStream for reflection
+ InputStream in = new BufferedInputStream(new PipedInputStream(out));
+ ) {
+ new Thread((Runnable)() -> {
+ try {
+ MmtfActions.writeToOutputStream(s,out);
+ } catch (Exception e) {
+ logger.error("Error generating MMTF output for {}",
+ s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e);
+ }
+ }).start();
+ viewer.openReader(null, in);
+ } catch (IOException e) {
+ logger.error("Error transfering {} to Jmol",
+ s.getStructureIdentifier()==null ? s.getStructureIdentifier().getIdentifier() : s.getName(), e);
+ }
+ } else {
+ // Use mmCIF format
+ String serialized = s.toMMCIF();
+ viewer.openStringInline(serialized);
+
}
-
+
evalString("save STATE state_1");
+
+ }
+
+ public void setStructure(final Structure s) {
+ // Set the default to MMCIF (until issue #629 is fixed)
+ setStructure(s, false);
}
/** assign a custom color to the Jmol chains command.
diff --git a/biojava-structure/pom.xml b/biojava-structure/pom.xml
index da120da772..88ee84457e 100644
--- a/biojava-structure/pom.xml
+++ b/biojava-structure/pom.xml
@@ -4,7 +4,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-structure
biojava-structure
@@ -40,13 +40,13 @@
org.biojava
biojava-alignment
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
org.biojava
biojava-core
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java
index 057a0e7497..bb7d1091e7 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/AminoAcidImpl.java
@@ -167,13 +167,9 @@ public Object clone() {
n.setAminoType(getAminoType());
n.setRecordType(recordType);
- // copy the atoms
- for (Atom atom1 : atoms) {
- Atom atom = (Atom) atom1.clone();
- n.addAtom(atom);
- atom.setGroup(n);
- }
-
+ //clone atoms and bonds.
+ cloneAtomsAndBonds(n);
+
// copying the alt loc groups if present, otherwise they stay null
if (getAltLocs()!=null && !getAltLocs().isEmpty()) {
for (Group altLocGroup:this.getAltLocs()) {
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java
index 643007df47..9b350cb60e 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/Chain.java
@@ -281,7 +281,7 @@ public interface Chain extends Serializable {
/**
* Returns the sequence of amino acids as it has been provided in the ATOM records.
* Non-standard residues will be present in the string only if the property
- * {@value org.biojava.nbio.structure.io.PDBFileReader.LOAD_CHEM_COMP_PROPERTY} has been set.
+ * {@value org.biojava.nbio.structure.io.PDBFileReader#LOAD_CHEM_COMP_PROPERTY} has been set.
* @return amino acid sequence as string
* @see #getSeqResSequence()
*/
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java
index d25a375891..de76404d2a 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/ChainImpl.java
@@ -637,7 +637,9 @@ public List getSeqResGroups() {
@Override
public void setSeqResGroups(List groups){
for (Group g: groups){
- g.setChain(this);
+ if (g != null) {
+ g.setChain(this);
+ }
}
this.seqResGroups = groups;
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java
index 29fffd6ee0..0ae91d6dfd 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/EntityInfo.java
@@ -28,13 +28,7 @@
import org.slf4j.LoggerFactory;
import java.io.Serializable;
-import java.util.ArrayList;
-import java.util.Collections;
-import java.util.HashMap;
-import java.util.List;
-import java.util.Map;
-import java.util.Set;
-import java.util.TreeSet;
+import java.util.*;
/**
* An object to contain the info from the PDB header for a Molecule.
@@ -811,17 +805,19 @@ public List getChains(){
}
private List getFirstModelChains() {
- List firstModel = new ArrayList<>();
- outer:
- for (String id: getChainIds()) {
- for (Chain chain:chains) {
- if (chain.getId().equals(id)) {
- firstModel.add(chain);
- break outer;
+
+ Map firstModelChains = new LinkedHashMap<>();
+ Set lookupChainIds = new HashSet<>(getChainIds());
+
+ for (Chain chain : chains) {
+ if (lookupChainIds.contains(chain.getId())) {
+ if (!firstModelChains.containsKey(chain.getId())) {
+ firstModelChains.put(chain.getId(), chain);
}
}
}
- return firstModel;
+
+ return new ArrayList<>(firstModelChains.values());
}
/**
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java
index dded705625..39efab13ae 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/Group.java
@@ -64,13 +64,14 @@ public interface Group extends Serializable {
public int size();
/**
- * Return true or false, depending if this group has 3D coordinates or not.
+ * Return true or false, depending if this group has 3D coordinates or not.
*
* @return true if Group has 3D coordinates
*/
public boolean has3D ();
- /** Flag if group has 3D data .
+ /**
+ * Flag if group has 3D data .
*
* @param flag true to set flag that this Group has 3D coordinates
*/
@@ -84,13 +85,15 @@ public interface Group extends Serializable {
*/
public GroupType getType();
- /** Add an atom to this group.
+ /**
+ * Add an atom to this group.
*
* @param atom an Atom object
*/
public void addAtom(Atom atom);
- /** Get list of atoms.
+ /**
+ * Get list of atoms.
*
* @return a List object representing the atoms
* @see #setAtoms(List)
@@ -98,7 +101,8 @@ public interface Group extends Serializable {
public List getAtoms() ;
- /** Set the atoms of this group.
+ /**
+ * Set the atoms of this group.
* @see {@link Atom}
* @param atoms a list of atoms
*/
@@ -180,21 +184,24 @@ public interface Group extends Serializable {
public boolean hasAminoAtoms() ;
- /** tests in the Chemical Component Dictionary, if this group is a polymeric group
+ /**
+ * Check if this group is a polymeric group, from the definition in Chemical Component Dictionary
*
* @return true if a polymeric group
*/
public boolean isPolymeric();
- /** Tests in the Chemical Component Dictionary, if this group is an amino acid
+ /**
+ * Check if this group is an aminoacid group, from the definition in Chemical Component Dictionary
*
* @return true if an amino acid
*/
public boolean isAminoAcid();
- /** Tests in the Chemical Component Dictionary, if this group is a nucleotide
+ /**
+ * Check if this group is a nucleotide group, from the definition in Chemical Component Dictionary
*
* @return true if a nucleotide
*/
@@ -213,23 +220,25 @@ public interface Group extends Serializable {
*/
public void setProperties(Map properties) ;
- /** return properties.
+ /**
+ * Return properties.
* @see #setProperties
*
* @return a HashMap object representing the properties value
*/
public Map getProperties() ;
- /** set a single property .
+ /**
+ * Set a single property .
*
* @param key a String
* @param value an Object
* @see #getProperty
-
*/
public void setProperty(String key, Object value) ;
- /** get a single property .
+ /**
+ * Get a single property .
*
* @param key a String
* @return an Object
@@ -237,14 +246,16 @@ public interface Group extends Serializable {
*/
public Object getProperty(String key) ;
- /** get an Atom Iterator.
+ /**
+ * Get an Atom Iterator.
*
* @return an Iterator object
*/
public Iterator iterator() ;
- /** returns and identical copy of this Group object .
+ /**
+ * Returns and identical copy of this Group object .
* @return and identical copy of this Group object
*/
public Object clone();
@@ -267,7 +278,7 @@ public interface Group extends Serializable {
public Chain getChain() ;
/**
- * returns a dynamically created ResidueNumber for the group - this
+ * Returns a dynamically created ResidueNumber for the group - this
* contains the chainId, resNum and insCode of the group.
* @see ResidueNumber
* @return ResidueNumber for the group.
@@ -276,13 +287,15 @@ public interface Group extends Serializable {
public ResidueNumber getResidueNumber();
- /** sets the ResidueNumber for this Group
+ /**
+ * Sets the ResidueNumber for this Group
*
* @param residueNumber the PDB residueNumber
*/
public void setResidueNumber(ResidueNumber residueNumber);
- /** Utility method to temporarily set a chainID for a group, if a parent chain object does not exist yet.
+ /**
+ * Utility method to temporarily set a chainID for a group, if a parent chain object does not exist yet.
* Not recommended for general use other than parsing.
*
* @param chainId
@@ -301,41 +314,66 @@ public interface Group extends Serializable {
*/
public String getChainId();
- /** Set the Chemical Component that closer describes this group.
+ /**
+ * Set the Chemical Component that closer describes this group.
*
* @param cc the chemical component
*/
public void setChemComp(ChemComp cc);
- /** Get the chemical component that closer describes this group. If the information does not exist yet, fetches the information from PDB web site.
+ /**
+ * Get the chemical component that closer describes this group. If the information does not exist yet, fetches the information from PDB web site.
*
* @return the Chemical Component definition for this Group.
*/
public ChemComp getChemComp();
- /** Test if this group has alternate locations.
+ /**
+ * Check if this group has alternate location groups.
*
* @return boolean flag if there are alternate locations.
+ * @see #getAltLocs()
*/
public boolean hasAltLoc();
- /** Get the list of alternate locations.
+ /**
+ * Get the list of other alternate location groups.
+ *
+ * The main group (this group) will contain the first altloc (be it the default '.' or 'A' or a mix of '.' and 'A').
+ *
+ * This method will return the altloc groups that are not the main group, e.g.:
+ *
+ *
if '.' (default), 'A' and 'B' altlocs are present in file, the main group will contain
+ * the default '.' and this method will return 2 altloc groups
+ *
+ *
+ * if 'A' and 'B' are present in file without a default '.' group, then the main group will contain the 'A'
+ * location whilst this method will return only 1 altloc group with the 'B' location
+ *
+ *
+ *
+ * Note that atoms with the default altloc (.) are included in all groups. Atoms with other altlocs (typically A, B, etc)
+ * will be sorted into groups by altloc.
+ *
+ * Thus it can happen that an altloc group duplicate the contents of the main group.
*
* @return List of other groups that are on alternate locations
*/
public List getAltLocs();
- /** Add a group that is an alternate location for this group.
+ /**
+ * Add a group that is an alternate location for this group.
*
+ * @param g the altloc group to add
*/
public void addAltLoc(Group g);
/**
* Determines if this group is water.
*
- * @see {@link GroupType#WATERNAMES}
+ * @see GroupType#WATERNAMES
* @return true if it's water, false otherwise.
*/
public boolean isWater();
@@ -349,7 +387,8 @@ public interface Group extends Serializable {
public Group getAltLocGroup(Character altLoc);
- /** attempts to reduce the memory imprint of this group by trimming
+ /**
+ * Attempts to reduce the memory imprint of this group by trimming
* all internal Collection objects to the required size.
*
*/
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java
index 3181f659e5..d767d37daf 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/HetatomImpl.java
@@ -453,13 +453,9 @@ public Object clone() {
n.setPDBName(getPDBName());
- // copy the atoms
- for (Atom atom1 : atoms) {
- Atom atom = (Atom) atom1.clone();
- n.addAtom(atom);
- atom.setGroup(n);
- }
-
+ //clone atoms and bonds.
+ cloneAtomsAndBonds(n);
+
// copying the alt loc groups if present, otherwise they stay null
if (altLocs!=null) {
for (Group altLocGroup:this.altLocs) {
@@ -474,6 +470,30 @@ public Object clone() {
return n;
}
+
+ protected void cloneAtomsAndBonds(Group newGroup) {
+ // copy the atoms
+ for (Atom atom1 : atoms) {
+ Atom atom = (Atom) atom1.clone();
+ newGroup.addAtom(atom);
+ atom.setGroup(newGroup);
+ }
+ // copy the bonds
+ for (int i=0;i bonds1 = atom1.getBonds();
+ if (bonds1 != null) {
+ for (Bond b : bonds1) {
+ int atomAIndex = atoms.indexOf(b.getAtomA());
+ int atomBIndex = atoms.indexOf(b.getAtomB());
+ // The order of the atoms are the same on the original and the cloned object, which we use here.
+ Bond newBond = new BondImpl(newGroup.getAtom(atomAIndex), newGroup.getAtom(atomBIndex), b.getBondOrder(), false);
+ newGroup.getAtom(i).addBond(newBond);
+ }
+ }
+ }
+ }
+
/** the Hibernate database ID
*
* @return the id
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java
index d3660794a1..b12e0ce453 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/NucleotideImpl.java
@@ -101,13 +101,9 @@ public Object clone() {
n.setPDBName(getPDBName());
- // copy the atoms
- for (Atom atom1 : atoms) {
- Atom atom = (Atom) atom1.clone();
- n.addAtom(atom);
- atom.setGroup(n);
- }
-
+ //clone atoms and bonds.
+ cloneAtomsAndBonds(n);
+
// copying the alt loc groups if present, otherwise they stay null
if (getAltLocs()!=null && !getAltLocs().isEmpty()) {
for (Group altLocGroup:this.getAltLocs()) {
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java
index e96bb2eb0a..58c777dde0 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/StructureTools.java
@@ -1842,7 +1842,8 @@ public static boolean isChainWaterOnly(Chain c) {
return c.isWaterOnly();
}
- /** @deprecated use {@link Chain#isPureNonPolymer()} instead.
+ /**
+ * @deprecated use {@link Chain#isPureNonPolymer()} instead.
*/
@Deprecated
public static boolean isChainPureNonPolymer(Chain c) {
@@ -1851,8 +1852,9 @@ public static boolean isChainPureNonPolymer(Chain c) {
}
/**
- * Cleans up the structure's alternate location groups. All alternate location groups should have all atoms (except in the case of microheterogenity) or when a deuetuim exiss.
- * Ensure that all the alt loc groups have all the atoms in the main group
+ * Cleans up the structure's alternate location (altloc) groups. All alternate location groups should have all atoms (except
+ * in the case of microheterogenity) or when a deuterium exists.
+ * Ensure that all the alt loc groups have all the atoms in the main group.
* @param structure The Structure to be cleaned up
*/
public static void cleanUpAltLocs(Structure structure) {
@@ -1866,10 +1868,7 @@ public static void cleanUpAltLocs(Structure structure) {
// Fix for microheterogenity
if (altLocGroup.getPDBName().equals(group.getPDBName())) {
// If it's a Hydrogen then we check for it's Deuterated brother
- if(hasDeuteratedEquiv(groupAtom, altLocGroup)){
-
- }
- else{
+ if(!hasDeuteratedEquiv(groupAtom, altLocGroup)){
altLocGroup.addAtom(groupAtom);
}
}
@@ -1896,7 +1895,7 @@ public static boolean hasNonDeuteratedEquiv(Atom atom, Group currentGroup) {
}
/**
- * Check to see if a Hydorgen has a Deuterated brother in the group.
+ * Check to see if a Hydrogen has a Deuterated brother in the group.
* @param atom the input atom that is putatively hydorgen
* @param currentGroup the group the atom is in
* @return true if the atom is hydrogen and it's Deuterium equiv exists.
@@ -1915,4 +1914,5 @@ private static String replaceFirstChar(String name, char c, char d) {
}
return name;
}
+
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java
index 80ea228b05..d4f6c7222a 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/LocalPDBDirectory.java
@@ -688,7 +688,7 @@ public static String getServerName() {
name = DEFAULT_PDB_FILE_SERVER;
logger.debug("Using default PDB file server {}",name);
} else {
- if (!name.startsWith("http://") && !name.startsWith("ftp://")) {
+ if (!name.startsWith("http://") && !name.startsWith("ftp://") && !name.startsWith("https://")) {
logger.warn("Server name {} read from system property {} does not have a leading protocol string. Adding http:// to it", name, PDB_FILE_SERVER_PROPERTY);
name = "http://"+name;
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java
index da5f29d569..6216f9d945 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/MMCIFFileTools.java
@@ -22,9 +22,7 @@
import java.lang.reflect.Field;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.List;
+import java.util.*;
import org.biojava.nbio.structure.Atom;
import org.biojava.nbio.structure.Chain;
@@ -336,25 +334,25 @@ public static Cell convertCrystalCellToCell(CrystalCell c) {
/**
* Converts an Atom object to an {@link AtomSite} object.
* @param a
- * @param model
- * @param chainId
- * @param internalChainId
+ * @param model the model number for the output AtomSites
+ * @param chainName the chain identifier (author id) for the output AtomSites
+ * @param chainId the internal chain identifier (asym id) for the output AtomSites
* @return
*/
- public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainId, String internalChainId) {
- return convertAtomToAtomSite(a, model, chainId, internalChainId, a.getPDBserial());
+ public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainName, String chainId) {
+ return convertAtomToAtomSite(a, model, chainName, chainId, a.getPDBserial());
}
/**
* Converts an Atom object to an {@link AtomSite} object.
- * @param a
- * @param model
- * @param chainId
- * @param internalChainId
+ * @param a the atom
+ * @param model the model number for the output AtomSites
+ * @param chainName the chain identifier (author id) for the output AtomSites
+ * @param chainId the internal chain identifier (asym id) for the output AtomSites
* @param atomId the atom id to be written to AtomSite
* @return
*/
- public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainId, String internalChainId, int atomId) {
+ public static AtomSite convertAtomToAtomSite(Atom a, int model, String chainName, String chainId, int atomId) {
/*
ATOM 7 C CD . GLU A 1 24 ? -10.109 15.374 38.853 1.00 50.05 ? ? ? ? ? ? 24 GLU A CD 1
@@ -406,7 +404,7 @@ record = "ATOM";
atomSite.setLabel_atom_id(a.getName());
atomSite.setLabel_alt_id(altLocStr);
atomSite.setLabel_comp_id(g.getPDBName());
- atomSite.setLabel_asym_id(internalChainId);
+ atomSite.setLabel_asym_id(chainId);
atomSite.setLabel_entity_id(entityId);
atomSite.setLabel_seq_id(labelSeqId);
atomSite.setPdbx_PDB_ins_code(insCode);
@@ -417,7 +415,7 @@ record = "ATOM";
atomSite.setB_iso_or_equiv(FileConvert.d2.format(a.getTempFactor()));
atomSite.setAuth_seq_id(Integer.toString(g.getResidueNumber().getSeqNum()));
atomSite.setAuth_comp_id(g.getPDBName());
- atomSite.setAuth_asym_id(chainId);
+ atomSite.setAuth_asym_id(chainName);
atomSite.setAuth_atom_id(a.getName());
atomSite.setPdbx_PDB_model_num(Integer.toString(model));
@@ -425,48 +423,54 @@ record = "ATOM";
}
/**
- * Converts a Group into a List of {@link AtomSite} objects
- * @param g
- * @param model
- * @param chainId
- * @param internalChainId
+ * Converts a Group into a List of {@link AtomSite} objects.
+ * Atoms in other altloc groups (different from the main group) are also included, removing possible duplicates
+ * via using the atom identifier to assess uniqueness.
+ * @param g the group
+ * @param model the model number for the output AtomSites
+ * @param chainName the chain identifier (author id) for the output AtomSites
+ * @param chainId the internal chain identifier (asym id) for the output AtomSites
* @return
*/
- private static List convertGroupToAtomSites(Group g, int model, String chainId, String internalChainId) {
+ public static List convertGroupToAtomSites(Group g, int model, String chainName, String chainId) {
- List list = new ArrayList();
+ // The alt locs can have duplicates, since at parsing time we make sure that all alt loc groups have
+ // all atoms (see StructureTools#cleanUpAltLocs)
+ // Thus we have to remove duplicates here by using the atom id
+ // See issue https://github.com/biojava/biojava/issues/778 and TestAltLocs.testMmcifWritingAllAltlocs/testMmcifWritingPartialAltlocs
+ Map uniqueAtomSites = new LinkedHashMap<>();
int groupsize = g.size();
for ( int atompos = 0 ; atompos < groupsize; atompos++) {
- Atom a = null ;
-
- a = g.getAtom(atompos);
+ Atom a = g.getAtom(atompos);
if ( a == null)
continue ;
- list.add(convertAtomToAtomSite(a, model, chainId, internalChainId));
-
+ uniqueAtomSites.put(a.getPDBserial(), convertAtomToAtomSite(a, model, chainName, chainId));
}
+
if ( g.hasAltLoc()){
for (Group alt : g.getAltLocs() ) {
- list.addAll(convertGroupToAtomSites(alt, model, chainId, internalChainId));
+ for (AtomSite atomSite : convertGroupToAtomSites(alt, model, chainName, chainId)) {
+ uniqueAtomSites.put(Integer.parseInt(atomSite.getId()), atomSite);
+ }
}
}
- return list;
+ return new ArrayList<>(uniqueAtomSites.values());
}
/**
* Converts a Chain into a List of {@link AtomSite} objects
- * @param c
- * @param model
- * @param authorId
- * @param asymId
+ * @param c the chain
+ * @param model the model number for the output AtomSites
+ * @param chainName the chain identifier (author id) for the output AtomSites
+ * @param chainId the internal chain identifier (asym id) for the output AtomSites
* @return
*/
- public static List convertChainToAtomSites(Chain c, int model, String authorId, String asymId) {
+ public static List convertChainToAtomSites(Chain c, int model, String chainName, String chainId) {
- List list = new ArrayList();
+ List list = new ArrayList<>();
if (c.getEntityInfo()==null) {
logger.warn("No Compound (entity) found for chain {}: entity_id will be set to 0, label_seq_id will be the same as auth_seq_id", c.getName());
@@ -476,7 +480,7 @@ public static List convertChainToAtomSites(Chain c, int model, String
Group g= c.getAtomGroup(h);
- list.addAll(convertGroupToAtomSites(g, model, authorId, asymId));
+ list.addAll(convertGroupToAtomSites(g, model, chainName, chainId));
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java
index 70cca55f83..3ce4bde692 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/mmcif/SimpleMMcifConsumer.java
@@ -767,7 +767,6 @@ public void documentEnd() {
// Now make sure all altlocgroups have all the atoms in all the groups
StructureTools.cleanUpAltLocs(structure);
-
// NOTE bonds and charges can only be done at this point that the chain id mapping is properly sorted out
if (!params.isHeaderOnly()) {
if ( params.shouldCreateAtomBonds()) {
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java
index e47b112a6b..84cd9ae138 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsChainToUniprotMapping.java
@@ -66,7 +66,7 @@ public class SiftsChainToUniprotMapping {
static {
try {
- DEFAULT_URL = new URL("ftp://ftp.ebi.ac.uk/pub/databases/msd/sifts/flatfiles/tsv/pdb_chain_uniprot.tsv.gz");
+ DEFAULT_URL = new URL("http://ftp.ebi.ac.uk/pub/databases/msd/sifts/flatfiles/tsv/pdb_chain_uniprot.tsv.gz");
} catch (MalformedURLException e) {
throw new RuntimeException(e);
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java
index 7340be1ee5..7c67305f3c 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/io/sifts/SiftsMappingProvider.java
@@ -41,7 +41,7 @@ public class SiftsMappingProvider {
private final static Logger logger = LoggerFactory.getLogger(SiftsMappingProvider.class);
- private static final String EBI_SIFTS_FILE_LOCATION = "ftp://ftp.ebi.ac.uk/pub/databases/msd/sifts/xml/%s.xml.gz";
+ private static final String EBI_SIFTS_FILE_LOCATION = "http://ftp.ebi.ac.uk/pub/databases/msd/sifts/xml/%s.xml.gz";
private static String fileLoc = EBI_SIFTS_FILE_LOCATION;
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java
index 9faca71668..8c1832cf00 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/quaternary/BiologicalAssemblyBuilder.java
@@ -144,8 +144,9 @@ public int compare(BiologicalAssemblyTransformation t1, BiologicalAssemblyTransf
// set sort order only if the two ids are identical
if (t1.getId().equals(t2.getId())) {
return chainIds.indexOf(t1.getChainId()) - chainIds.indexOf(t2.getChainId());
+ } else {
+ return t1.getId().compareTo(t2.getId());
}
- return 0;
}
});
}
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java
index 25b6e25b8c..b4860b2cf1 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/rcsb/RCSBUpdates.java
@@ -33,7 +33,7 @@
public class RCSBUpdates {
// The URL for acquiring the data
- public static final String baseURL = "ftp://ftp.rcsb.org/pub/pdb/data/status/latest/";
+ public static final String baseURL = "http://ftp.rcsb.org/pub/pdb/data/status/latest/";
/**
*
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java
index 3a125fe078..8e623c24f6 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/secstruc/SecStrucCalc.java
@@ -230,7 +230,7 @@ private void createLadders(){
private void updateSheets() {
- logger.debug(" got " +ladders.size() + " ladders!");
+ logger.debug(" got {} ladders!", ladders.size());
for (Ladder ladder : ladders){
logger.debug(ladder.toString());
@@ -308,7 +308,7 @@ private void connectLadders() {
if (hasBulge(l1,l2)) {
l1.connectedTo = j;
l2.connectedFrom = i;
- logger.debug("Bulge from " + i + " to " + j);
+ logger.debug("Bulge from {} to {}", i, j);
}
}
}
@@ -362,8 +362,7 @@ private void registerBridge(int i, int j, BridgeType btype) {
boolean b2 = getSecStrucState(j).addBridge(bridge);
if (!b1 && !b2)
- logger.warn("Ignoring Bridge between residues" + i + " and " + j
- + ". DSSP assignment might differ.");
+ logger.warn("Ignoring Bridge between residues {} and {}. DSSP assignment might differ.", i, j);
bridges.add(bridge);
}
@@ -799,11 +798,11 @@ private void checkAddHBond(int i, int j){
SecStrucGroup one = groups[i];
if (one.getPDBName().equals("PRO")){
- logger.debug("Ignore: PRO " + one.getResidueNumber());
+ logger.debug("Ignore: PRO {}", one.getResidueNumber());
return;
}
if (!one.hasAtom("H")) {
- logger.debug("Residue "+one.getResidueNumber()+" has no H");
+ logger.debug("Residue {} has no H",one.getResidueNumber());
return;
}
@@ -817,7 +816,7 @@ private void checkAddHBond(int i, int j){
logger.warn("Energy calculation failed", e);
return;
}
- logger.debug("Energy between positions ("+i+","+j+"): "+energy);
+ logger.debug("Energy between positions ({},{}): ",i,j,energy);
trackHBondEnergy(i,j,energy);
}
@@ -848,12 +847,9 @@ private static double calculateHBondEnergy(SecStrucGroup one,
double dho = Calc.getDistance(O,H);
double dnc = Calc.getDistance(C,N);
- logger.debug(" cccc: " + one.getResidueNumber() +
- " " + one.getPDBName() + " " +two.getResidueNumber()+
- " " + two.getPDBName() + String.format(" O ("+
- O.getPDBserial()+")..N ("+ N.getPDBserial()+
- "):%4.1f | ho:%4.1f - hc:%4.1f + nc:%4.1f - no:%4.1f ",
- dno,dho,dhc,dnc,dno));
+ logger.debug(" cccc: {} {} {} {} O ({})..N ({}):{} | ho:{} - hc:{} + nc:{} - no:{}",
+ one.getResidueNumber(),one.getPDBName(),two.getResidueNumber(),two.getPDBName(),
+ O.getPDBserial(),N.getPDBserial(),dno,dho,dhc,dnc,dno);
//there seems to be a contact!
if ( (dno < MINDIST) || (dhc < MINDIST) ||
@@ -866,8 +862,7 @@ private static double calculateHBondEnergy(SecStrucGroup one,
double energy = e1 + e2;
- logger.debug(String.format(" N (%d) O(%d): %4.1f : %4.2f ",
- N.getPDBserial(),O.getPDBserial(), (float) dno, energy));
+ logger.debug(" N ({}) O({}): {} : {} ",N.getPDBserial(),O.getPDBserial(),(float) dno,energy);
//Avoid too strong energy
if (energy > HBONDLOWENERGY) return energy;
@@ -882,7 +877,7 @@ private static double calculateHBondEnergy(SecStrucGroup one,
private void trackHBondEnergy(int i, int j, double energy) {
if (groups[i].getPDBName().equals("PRO")) {
- logger.debug("Ignore: PRO " + groups[i].getResidueNumber());
+ logger.debug("Ignore: PRO {}",groups[i].getResidueNumber());
return;
}
@@ -897,7 +892,7 @@ private void trackHBondEnergy(int i, int j, double energy) {
//Acceptor: N-H-->O
if (energy < acc1e) {
- logger.debug(energy +"<"+acc1e);
+ logger.debug("{} < {}",energy,acc1e);
stateOne.setAccept2(stateOne.getAccept1());
HBond bond = new HBond();
@@ -907,7 +902,7 @@ private void trackHBondEnergy(int i, int j, double energy) {
stateOne.setAccept1(bond);
} else if ( energy < acc2e ) {
- logger.debug(energy +"<"+acc2e);
+ logger.debug("{} < {}",energy,acc2e);
HBond bond = new HBond();
bond.setEnergy(energy);
@@ -919,7 +914,7 @@ private void trackHBondEnergy(int i, int j, double energy) {
//The other side of the bond: donor O-->N-H
if (energy < don1e) {
- logger.debug(energy +"<"+don1e);
+ logger.debug("{} < {}",energy,don1e);
stateTwo.setDonor2(stateTwo.getDonor1());
HBond bond = new HBond();
@@ -929,7 +924,7 @@ private void trackHBondEnergy(int i, int j, double energy) {
stateTwo.setDonor1(bond);
} else if ( energy < don2e ) {
- logger.debug(energy +"<"+don2e);
+ logger.debug("{} < {}",energy,don2e);
HBond bond = new HBond();
bond.setEnergy(energy);
@@ -951,7 +946,7 @@ private void calculateTurns(){
//Check for H bond from NH(i+n) to CO(i)
if (isBonded(i, i+turn)) {
- logger.debug("Turn at ("+i+","+(i+turn)+") turn "+turn);
+ logger.debug("Turn at ({},{}) turn {}",i,(i+turn),turn);
getSecStrucState(i).setTurn('>', turn);
getSecStrucState(i+turn).setTurn('<', turn);
//Bracketed residues get the helix number
@@ -998,7 +993,7 @@ private boolean isBonded(int i, int j) {
(acc2p == i && acc2e < HBONDHIGHENERGY);
if (hbond){
- logger.debug("*** H-bond from CO of " + i + " to NH of " + j);
+ logger.debug("*** H-bond from CO of {} to NH of {}", i, j);
return true;
}
return false ;
@@ -1105,7 +1100,7 @@ private void checkSetTurns() {
private void checkSetHelix(int n, SecStrucType type){
int idx = n - 3;
- logger.debug("Set helix " + type + " " + n + " " + idx);
+ logger.debug("Set helix {} {} {}", type, n, idx);
for (int i = 1; i < groups.length-n; i++) {
diff --git a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java
index 9896e740ff..cdd9a67407 100644
--- a/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java
+++ b/biojava-structure/src/main/java/org/biojava/nbio/structure/symmetry/utils/BlastClustReader.java
@@ -20,6 +20,9 @@
*/
package org.biojava.nbio.structure.symmetry.utils;
+import org.slf4j.Logger;
+import org.slf4j.LoggerFactory;
+
import java.io.BufferedReader;
import java.io.IOException;
import java.io.InputStream;
@@ -33,10 +36,14 @@ public class BlastClustReader implements Serializable {
private static final long serialVersionUID = 1L;
+ private static final Logger logger = LoggerFactory.getLogger(BlastClustReader.class);
+
private int sequenceIdentity = 0;
- private List> clusters = new ArrayList>();
- private static final String coreUrl = "ftp://resources.rcsb.org/sequence/clusters/";
- private static List seqIdentities = Arrays.asList(30, 40, 50, 70, 90, 95, 100);
+ private List> clusters = new ArrayList<>();
+ // https://cdn.rcsb.org/resources/sequence/clusters/bc-95.out
+ private static final String coreUrl = "https://cdn.rcsb.org/resources/sequence/clusters/";
+
+ private static final List seqIdentities = Arrays.asList(30, 40, 50, 70, 90, 95, 100);
public BlastClustReader(int sequenceIdentity) {
this.sequenceIdentity = sequenceIdentity;
@@ -51,7 +58,7 @@ public Map getRepresentatives(String pdbId) {
loadClusters(sequenceIdentity);
String pdbIdUc = pdbId.toUpperCase();
- Map representatives = new LinkedHashMap();
+ Map representatives = new LinkedHashMap<>();
for (List cluster: clusters) {
// map fist match to representative
for (String chainId: cluster) {
@@ -138,48 +145,35 @@ private void loadClusters(int sequenceIdentity) {
}
if (!seqIdentities.contains(sequenceIdentity)) {
- System.err.println("Error: representative chains are not available for %sequence identity: "
- + sequenceIdentity);
+ logger.error("Representative chains are not available for %sequence identity: {}", sequenceIdentity);
return;
}
+ String urlString = coreUrl + "bc-" + sequenceIdentity + ".out";
+
try {
- URL u = new URL(coreUrl + "bc-" + sequenceIdentity + ".out");
- InputStream stream = u.openStream();
- // URLConnection connection = u.openConnection();
- // connection.setConnectTimeout(60000);
- // InputStream stream = connection.getInputStream();
-
- if (stream != null) {
- BufferedReader reader = new BufferedReader(new InputStreamReader(stream));
-
- String line = null;
- try {
- while ((line = reader.readLine()) != null) {
- line = line.replaceAll("_", ".");
- List cluster = Arrays.asList(line.split(" "));
- clusters.add(cluster);
- }
- reader.close();
- stream.close();
- } catch (IOException e) {
- //e.printStackTrace();
- } finally {
-// try {
-// System.out.println("closing reader");
-// reader.close();
-// stream.close();
-// } catch (IOException e) {
-// e.printStackTrace();
-// }
- }
- }
- } catch (Exception e) {
- e.printStackTrace();
- }
+ URL u = new URL(urlString);
+ InputStream stream = u.openStream();
+
+ if (stream != null) {
+ BufferedReader reader = new BufferedReader(new InputStreamReader(stream));
+
+ String line = null;
+ while ((line = reader.readLine()) != null) {
+ line = line.replaceAll("_", ".");
+ List cluster = Arrays.asList(line.split(" "));
+ clusters.add(cluster);
+ }
+ reader.close();
+ stream.close();
+ } else {
+ throw new IOException("Got null stream for URL " + urlString);
+ }
+ } catch (IOException e) {
+ logger.error("Could not get sequence clusters from URL " + urlString + ". Error: " + e.getMessage());
+ }
- return;
}
}
diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java
index 55719fa305..5a66cdcae0 100644
--- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java
+++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestAltLocs.java
@@ -23,13 +23,19 @@
import org.biojava.nbio.structure.align.util.AtomCache;
import org.biojava.nbio.structure.io.FileParsingParameters;
import org.biojava.nbio.structure.io.mmcif.ChemCompGroupFactory;
+import org.biojava.nbio.structure.io.mmcif.MMCIFFileTools;
+import org.biojava.nbio.structure.io.mmcif.SimpleMMcifConsumer;
+import org.biojava.nbio.structure.io.mmcif.SimpleMMcifParser;
import org.biojava.nbio.structure.io.mmcif.chem.PolymerType;
import org.biojava.nbio.structure.io.mmcif.chem.ResidueType;
+import org.biojava.nbio.structure.io.mmcif.model.AtomSite;
import org.biojava.nbio.structure.io.mmcif.model.ChemComp;
import org.biojava.nbio.structure.io.mmcif.model.ChemCompBond;
import org.junit.Test;
+import java.io.BufferedReader;
import java.io.IOException;
+import java.io.StringReader;
import java.util.ArrayList;
import java.util.List;
@@ -85,7 +91,7 @@ public void testAltLocParsing() throws StructureException, IOException{
assertTrue("The group does not have an altLoc ", g.hasAltLoc());
- assertTrue("The nr of altLocs is not 1, but " + g.getAltLocs().size(), g.getAltLocs().size() == 1);
+ assertEquals(1, g.getAltLocs().size());
assertEquals( g.getPDBName(), "KOR");
@@ -93,20 +99,18 @@ public void testAltLocParsing() throws StructureException, IOException{
assertEquals(altLocG.getPDBName(),"K1R");
- assertEquals(275,groupCount);
+ assertEquals(275, groupCount);
// citric acid is now in its own chain
Chain b = s.getChain("B");
- assertTrue(b.getAtomGroups().size() == 1);
-
+ assertEquals(1, b.getAtomGroups().size());
ResidueNumber resNum2 = ResidueNumber.fromString("265");
Group g2 = a.getGroupByPDB(resNum2);
assertTrue(g2.hasAltLoc());
-
}
@Test
@@ -127,8 +131,7 @@ public void test2W72() throws IOException, StructureException{
Atom[] caA = StructureTools.getRepresentativeAtomArray(a);
- assertEquals(caA.length,141);
-
+ assertEquals(141, caA.length);
}
@@ -148,7 +151,6 @@ public void test1U7F() throws IOException, StructureException{
ensureAllAtomsSameAltCode(altGroup, g);
}
-
}
@Test
@@ -166,7 +168,6 @@ public void test1JXX() throws IOException, StructureException{
ensureAllAtomsSameAltCode(altGroup, g);
}
-
}
@@ -208,6 +209,10 @@ private void ensureAllAtomsSameAltCode(Group groupInputAltLocGroup, Group inputM
@Test
public void test1AAC() throws IOException, StructureException{
+ AtomCache cache = new AtomCache();
+ cache.setUseMmCif(false);
+ StructureIO.setAtomCache(cache);
+
Structure s = StructureIO.getStructure("1AAC");
Chain a = s.getPolyChainByPDB("A");
@@ -215,8 +220,9 @@ public void test1AAC() throws IOException, StructureException{
Group g = a.getGroupByPDB( ResidueNumber.fromString("27"));
testCBAtomInMainGroup(g);
- AtomCache cache = new AtomCache();
+ cache = new AtomCache();
cache.setUseMmCif(true);
+ StructureIO.setAtomCache(cache);
Structure s1 = cache.getStructure("1AAC");
Chain a1 = s1.getPolyChainByPDB("A");
@@ -225,20 +231,6 @@ public void test1AAC() throws IOException, StructureException{
testCBAtomInMainGroup(g1);
-
-
- // int pos = 0;
- // for (Group alt: g.getAltLocs()) {
- // pos++;
- // System.out.println("altLoc: " + pos + " " + alt);
- // for (Atom atom : alt.getAtoms()) {
- // System.out.print(atom.toPDB());
- // }
- // }
-
-
-
-
}
private void testCBAtomInMainGroup(Group g) {
@@ -248,7 +240,7 @@ private void testCBAtomInMainGroup(Group g) {
for (Atom atom : g.getAtoms()) {
//System.out.print(atom.toPDB());
- if ( atom.getName().equals(StructureTools.CA_ATOM_NAME)){
+ if ( atom.getName().equals(StructureTools.CB_ATOM_NAME)){
cbInMain = true;
break;
@@ -316,7 +308,7 @@ public void test3PIUpdb() throws IOException, StructureException{
}
}
- assertTrue(ca.length == caList.size());
+ assertEquals(ca.length, caList.size());
}
@@ -354,7 +346,7 @@ private void doTestAllAltLocsSamAtomsMainGroup(String pdbId) throws IOException,
for (Group g: c.getAtomGroups()){
for (Group altLocGroup:g.getAltLocs()) {
- assertEquals(altLocGroup.size(), g.size());
+ assertEquals(g.size(), altLocGroup.size());
}
}
}
@@ -482,7 +474,7 @@ public void test4CUPBonds() throws IOException, StructureException{
}
}
- assertTrue(ca.length == caList.size());
+ assertEquals(ca.length, caList.size());
}
@@ -534,7 +526,6 @@ public void test3PIUmmcif() throws IOException, StructureException{
}
-
}
if (! caInMain && g.hasAtom(StructureTools.CA_ATOM_NAME)){
// g.hasAtom checks altLocs
@@ -546,7 +537,6 @@ public void test3PIUmmcif() throws IOException, StructureException{
assertEquals(ca.length, caList.size());
-
}
@Test
@@ -592,7 +582,6 @@ public void test3U7Tmmcif() throws IOException, StructureException{
}
-
}
if (! caInMain && g.hasAtom(StructureTools.CA_ATOM_NAME)){
// g.hasAtom checks altLocs
@@ -604,6 +593,164 @@ public void test3U7Tmmcif() throws IOException, StructureException{
assertEquals(ca.length, caList.size());
+ }
+
+ @Test
+ public void testMmcifConversionPartialAltlocs() throws IOException {
+ String mmcifData =
+ "data_test\n" +
+ "loop_\n" +
+ "_atom_site.group_PDB \n" +
+ "_atom_site.id \n" +
+ "_atom_site.type_symbol \n" +
+ "_atom_site.label_atom_id \n" +
+ "_atom_site.label_alt_id \n" +
+ "_atom_site.label_comp_id \n" +
+ "_atom_site.label_asym_id \n" +
+ "_atom_site.label_entity_id \n" +
+ "_atom_site.label_seq_id \n" +
+ "_atom_site.pdbx_PDB_ins_code \n" +
+ "_atom_site.Cartn_x \n" +
+ "_atom_site.Cartn_y \n" +
+ "_atom_site.Cartn_z \n" +
+ "_atom_site.occupancy \n" +
+ "_atom_site.B_iso_or_equiv \n" +
+ "_atom_site.pdbx_formal_charge \n" +
+ "_atom_site.auth_seq_id \n" +
+ "_atom_site.auth_comp_id \n" +
+ "_atom_site.auth_asym_id \n" +
+ "_atom_site.auth_atom_id \n" +
+ "_atom_site.pdbx_PDB_model_num \n" +
+ "ATOM 102 N N . ARG A 1 13 ? 9.889 23.379 13.115 1.00 6.57 ? 102 ARG A N 1\n" +
+ "ATOM 103 C CA . ARG A 1 13 ? 9.540 23.003 14.482 1.00 7.05 ? 102 ARG A CA 1\n" +
+ "ATOM 104 C C . ARG A 1 13 ? 10.407 23.758 15.489 1.00 6.88 ? 102 ARG A C 1\n" +
+ "ATOM 105 O O . ARG A 1 13 ? 9.915 24.196 16.532 1.00 7.69 ? 102 ARG A O 1\n" +
+ "ATOM 106 C CB . ARG A 1 13 ? 9.706 21.494 14.688 1.00 9.07 ? 102 ARG A CB 1\n" +
+ "ATOM 107 C CG A ARG A 1 13 ? 8.757 20.644 13.854 0.50 14.39 ? 102 ARG A CG 1\n" +
+ "ATOM 108 C CG B ARG A 1 13 ? 8.693 20.645 13.938 0.50 13.58 ? 102 ARG A CG 1\n" +
+ "ATOM 109 C CD A ARG A 1 13 ? 9.109 19.164 13.950 0.50 18.14 ? 102 ARG A CD 1\n" +
+ "ATOM 110 C CD B ARG A 1 13 ? 8.710 19.216 14.456 0.50 16.34 ? 102 ARG A CD 1\n" +
+ "ATOM 111 N NE A ARG A 1 13 ? 8.983 18.644 15.310 0.50 20.72 ? 102 ARG A NE 1\n" +
+ "ATOM 112 N NE B ARG A 1 13 ? 8.315 19.158 15.861 0.50 23.99 ? 102 ARG A NE 1\n" +
+ "ATOM 113 C CZ A ARG A 1 13 ? 7.826 18.445 15.933 0.50 23.45 ? 102 ARG A CZ 1\n" +
+ "ATOM 114 C CZ B ARG A 1 13 ? 8.404 18.072 16.622 0.50 24.56 ? 102 ARG A CZ 1\n" +
+ "ATOM 115 N NH1 A ARG A 1 13 ? 6.683 18.718 15.321 0.50 23.60 ? 102 ARG A NH1 1\n" +
+ "ATOM 116 N NH1 B ARG A 1 13 ? 8.881 16.942 16.118 0.50 28.42 ? 102 ARG A NH1 1\n" +
+ "ATOM 117 N NH2 A ARG A 1 13 ? 7.812 17.972 17.172 0.50 24.80 ? 102 ARG A NH2 1\n" +
+ "ATOM 118 N NH2 B ARG A 1 13 ? 8.013 18.115 17.888 0.50 26.52 ? 102 ARG A NH2 1\n";
+
+ SimpleMMcifParser parser = new SimpleMMcifParser();
+ SimpleMMcifConsumer consumer = new SimpleMMcifConsumer();
+ parser.addMMcifConsumer(consumer);
+
+ BufferedReader buf = new BufferedReader(new StringReader(mmcifData));
+ parser.parse(buf);
+ buf.close();
+
+ Structure s = consumer.getStructure();
+ Chain c = s.getPolyChains().get(0);
+ assertEquals(1, c.getAtomGroups().size());
+ Group g = c.getAtomGroup(0);
+ assertEquals(11, g.size());
+
+ // there's the main group (. and A) plus the 2 alt loc groups (A and B). The alt locs will contain all the '.' atoms too
+ assertEquals(2, g.getAltLocs().size());
+
+ for (Atom a : g.getAtoms()) {
+ if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB"))
+ assertEquals(' ', a.getAltLoc().charValue());
+ else
+ assertEquals('A', a.getAltLoc().charValue());
+ }
+
+ assertEquals(11, g.getAltLocs().get(0).size());
+ for (Atom a : g.getAltLocs().get(0).getAtoms()) {
+ if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB"))
+ assertEquals(' ', a.getAltLoc().charValue());
+ else
+ assertEquals('A', a.getAltLoc().charValue());
+ }
+
+ assertEquals(11, g.getAltLocs().get(1).size());
+ for (Atom a : g.getAltLocs().get(1).getAtoms()) {
+ if (a.getName().equals("C") || a.getName().equals("N") || a.getName().equals("O") || a.getName().equals("CA") || a.getName().equals("CB"))
+ assertEquals(' ', a.getAltLoc().charValue());
+ else
+ assertEquals('B', a.getAltLoc().charValue());
+ }
+
+ List atomSites = MMCIFFileTools.convertChainToAtomSites(c, 1, "A", "A");
+ assertEquals(17, atomSites.size());
+
+ }
+
+ @Test
+ public void testMmcifConversionAllAltlocs() throws IOException {
+ String mmcifData =
+ "data_test\n" +
+ "loop_\n" +
+ "_atom_site.group_PDB \n" +
+ "_atom_site.id \n" +
+ "_atom_site.type_symbol \n" +
+ "_atom_site.label_atom_id \n" +
+ "_atom_site.label_alt_id \n" +
+ "_atom_site.label_comp_id \n" +
+ "_atom_site.label_asym_id \n" +
+ "_atom_site.label_entity_id \n" +
+ "_atom_site.label_seq_id \n" +
+ "_atom_site.pdbx_PDB_ins_code \n" +
+ "_atom_site.Cartn_x \n" +
+ "_atom_site.Cartn_y \n" +
+ "_atom_site.Cartn_z \n" +
+ "_atom_site.occupancy \n" +
+ "_atom_site.B_iso_or_equiv \n" +
+ "_atom_site.pdbx_formal_charge \n" +
+ "_atom_site.auth_seq_id \n" +
+ "_atom_site.auth_comp_id \n" +
+ "_atom_site.auth_asym_id \n" +
+ "_atom_site.auth_atom_id \n" +
+ "_atom_site.pdbx_PDB_model_num \n" +
+ "ATOM 204 N N A PRO A 1 23 ? 15.057 31.425 23.772 0.50 3.09 ? 112 PRO A N 1 \n" +
+ "ATOM 205 N N B PRO A 1 23 ? 14.762 31.778 23.217 0.50 15.25 ? 112 PRO A N 1 \n" +
+ "ATOM 206 C CA A PRO A 1 23 ? 16.391 30.930 23.416 0.50 5.82 ? 112 PRO A CA 1 \n" +
+ "ATOM 207 C CA B PRO A 1 23 ? 16.049 31.406 22.622 0.50 15.44 ? 112 PRO A CA 1 \n" +
+ "ATOM 208 C C A PRO A 1 23 ? 17.360 30.580 24.546 0.50 6.73 ? 112 PRO A C 1 \n" +
+ "ATOM 209 C C B PRO A 1 23 ? 16.971 30.922 23.734 0.50 15.04 ? 112 PRO A C 1 \n" +
+ "ATOM 210 O O A PRO A 1 23 ? 18.566 30.784 24.409 0.50 10.00 ? 112 PRO A O 1 \n" +
+ "ATOM 211 O O B PRO A 1 23 ? 18.076 31.430 23.925 0.50 14.61 ? 112 PRO A O 1 \n" +
+ "ATOM 212 C CB A PRO A 1 23 ? 16.931 32.050 22.542 0.50 8.38 ? 112 PRO A CB 1 \n" +
+ "ATOM 213 C CB B PRO A 1 23 ? 16.519 32.710 21.986 0.50 14.09 ? 112 PRO A CB 1 \n" +
+ "ATOM 214 C CG A PRO A 1 23 ? 16.424 33.256 23.263 0.50 7.59 ? 112 PRO A CG 1 \n" +
+ "ATOM 215 C CG B PRO A 1 23 ? 15.960 33.743 22.908 0.50 15.66 ? 112 PRO A CG 1 \n" +
+ "ATOM 216 C CD A PRO A 1 23 ? 14.980 32.886 23.580 0.50 6.98 ? 112 PRO A CD 1 \n" +
+ "ATOM 217 C CD B PRO A 1 23 ? 14.558 33.235 23.153 0.50 14.91 ? 112 PRO A CD 1 \n";
+
+ SimpleMMcifParser parser = new SimpleMMcifParser();
+ SimpleMMcifConsumer consumer = new SimpleMMcifConsumer();
+ parser.addMMcifConsumer(consumer);
+
+ BufferedReader buf = new BufferedReader(new StringReader(mmcifData));
+ parser.parse(buf);
+ buf.close();
+
+ Structure s = consumer.getStructure();
+ Chain c = s.getPolyChains().get(0);
+ assertEquals(1, c.getAtomGroups().size());
+
+ Group g = c.getAtomGroup(0);
+ assertEquals(7, g.size());
+
+ assertEquals(1, g.getAltLocs().size());
+
+ for (Atom a : g.getAtoms()) {
+ assertEquals('A', a.getAltLoc().charValue());
+ }
+ for (Atom a : g.getAltLocs().get(0).getAtoms()) {
+ assertEquals('B', a.getAltLoc().charValue());
+ }
+
+ List atomSites = MMCIFFileTools.convertChainToAtomSites(c, 1, "A", "A");
+ assertEquals(14, atomSites.size());
}
diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java
index bec887a967..0f60220a79 100644
--- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java
+++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCloning.java
@@ -24,14 +24,17 @@
*/
package org.biojava.nbio.structure;
+import static org.junit.Assert.assertEquals;
+import static org.junit.Assert.assertNotEquals;
+import static org.junit.Assert.assertNotNull;
import java.io.IOException;
import java.util.Iterator;
+import java.util.List;
import org.biojava.nbio.structure.align.util.AtomCache;
import org.biojava.nbio.structure.io.FileParsingParameters;
import org.junit.Test;
-import static org.junit.Assert.*;
public class TestCloning {
@@ -40,8 +43,8 @@ public void test1a4wCloning() throws StructureException, IOException {
Structure s;
- AtomCache cache = new AtomCache();
- FileParsingParameters params = new FileParsingParameters();
+ final AtomCache cache = new AtomCache();
+ final FileParsingParameters params = new FileParsingParameters();
params.setAlignSeqRes(true);
cache.setFileParsingParams(params);
@@ -49,22 +52,19 @@ public void test1a4wCloning() throws StructureException, IOException {
s = StructureIO.getStructure("1a4w");
- Structure c = s.clone();
+ final Structure c = s.clone();
- compareCloned(s,c);
+ compareCloned(s, c);
}
-
-
@Test
public void testAsymUnitCloning() throws StructureException, IOException {
Structure s;
-
- AtomCache cache = new AtomCache();
- FileParsingParameters params = new FileParsingParameters();
+ final AtomCache cache = new AtomCache();
+ final FileParsingParameters params = new FileParsingParameters();
params.setAlignSeqRes(false);
cache.setFileParsingParams(params);
@@ -72,79 +72,113 @@ public void testAsymUnitCloning() throws StructureException, IOException {
s = StructureIO.getStructure("1stp");
- Structure c = s.clone();
+ final Structure c = s.clone();
- compareCloned(s,c);
+ compareCloned(s, c);
}
@Test
public void testBioUnitCloning() throws StructureException, IOException {
Structure s;
- s = StructureIO.getBiologicalAssembly("1stp",1);
+ s = StructureIO.getBiologicalAssembly("1stp", 1);
- Structure c = s.clone();
+ final Structure c = s.clone();
- compareCloned(s,c);
+ compareCloned(s, c);
}
/**
* A Structure with alt locs, we make sure they are being cloned too
+ *
* @throws StructureException
* @throws IOException
*/
@Test
public void test3piuCloning() throws StructureException, IOException {
- AtomCache cache = new AtomCache();
- FileParsingParameters params = new FileParsingParameters();
+ final AtomCache cache = new AtomCache();
+ final FileParsingParameters params = new FileParsingParameters();
params.setAlignSeqRes(true);
cache.setFileParsingParams(params);
StructureIO.setAtomCache(cache);
- Structure s = StructureIO.getStructure("3piu");
+ final Structure s = StructureIO.getStructure("3piu");
- Structure c = s.clone();
+ final Structure c = s.clone();
compareCloned(s, c);
}
- private void compareCloned(Structure s, Structure c) throws StructureException {
+ private void compareCloned(final Structure s, final Structure c) throws StructureException {
assertEquals(s.getChains().size(), c.getChains().size());
- for ( Chain chain : s.getChains()) {
+ for (final Chain chain : s.getChains()) {
- Chain test = c.getChain(chain.getId());
+ final Chain test = c.getChain(chain.getId());
- assertEquals("Could not correctly clone seqres for chain " + chain.getId() , chain.getSeqResLength(),test.getSeqResLength());
+ assertEquals("Could not correctly clone seqres for chain " + chain.getId(), chain.getSeqResLength(),
+ test.getSeqResLength());
- assertEquals("Could not correctly clone atom records for chain " + chain.getId() , chain.getAtomLength(),test.getAtomLength());
+ assertEquals("Could not correctly clone atom records for chain " + chain.getId(), chain.getAtomLength(),
+ test.getAtomLength());
Iterator it = test.getAtomGroups().iterator();
- for (Group g : chain.getAtomGroups()) {
- Group testGroup = it.next();
- //if (g.hasAltLoc()) {
- // System.out.println(g.toString());
- //}
+ for (final Group g : chain.getAtomGroups()) {
+ final Group testGroup = it.next();
+ // if (g.hasAltLoc()) {
+ // System.out.println(g.toString());
+ // }
assertEquals(g.getAltLocs().size(), testGroup.getAltLocs().size());
}
-
+
it = test.getSeqResGroups().iterator();
- for (Group g: chain.getSeqResGroups()) {
- Group testGroup = it.next();
+ for (final Group g : chain.getSeqResGroups()) {
+ final Group testGroup = it.next();
assertEquals(g.getAltLocs().size(), testGroup.getAltLocs().size());
}
}
- Atom[] allAtoms = StructureTools.getAllAtomArray(s);
+ final Atom[] allAtoms = StructureTools.getAllAtomArray(s);
+
+ final Atom[] allAtomsCloned = StructureTools.getAllAtomArray(c);
+
+ assertEquals(allAtoms.length, allAtomsCloned.length);
+
+ }
+
+ @Test
+ public void testBondCloning() throws IOException, StructureException {
+
+ final AtomCache cache = new AtomCache();
+ cache.setUseMmCif(true);
+
+ final FileParsingParameters params = cache.getFileParsingParams();
+ params.setCreateAtomBonds(true);
+ cache.setFileParsingParams(params);
+
+ final Structure s = cache.getStructure("2I13");
+ List bonds = s.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds();
+ assertNotNull(bonds);
+
+ Structure s2 = s.clone();
+ List bonds2 = s2.getNonPolyChain("G").getAtomGroup(0).getAtom(0).getBonds();
+ assertNotNull(bonds2);
- Atom[] allAtomsCloned = StructureTools.getAllAtomArray(c);
+ assertEquals(bonds.toString(), bonds2.toString());
+ // But the objects should be different as the atoms are clones
+ assertNotEquals(bonds.toArray(), bonds2.toArray());
- assertEquals(allAtoms.length,allAtomsCloned.length);
+ // Also test for polymeric chains
+ bonds = s.getPolyChain("E").getAtomGroup(0).getAtom(0).getBonds();
+ assertNotNull(bonds);
+ s2 = s.clone();
+ bonds2 = s2.getPolyChain("E").getAtomGroup(0).getAtom(0).getBonds();
+ assertNotNull(bonds2);
}
}
diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java
similarity index 85%
rename from biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java
rename to biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java
index 33ddb9ac86..f0926364b9 100644
--- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestCompoundResIndexMapping.java
+++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestEntityResIndexMapping.java
@@ -24,14 +24,21 @@
import java.io.IOException;
import java.io.InputStream;
+import java.util.ArrayList;
+import java.util.List;
import java.util.zip.GZIPInputStream;
import org.biojava.nbio.structure.align.util.AtomCache;
import org.biojava.nbio.structure.io.FileParsingParameters;
import org.biojava.nbio.structure.io.PDBFileParser;
+import org.junit.Ignore;
import org.junit.Test;
-public class TestCompoundResIndexMapping {
+/**
+ * Various tests for functionality in {@link EntityInfo} and {@link org.biojava.nbio.structure.io.EntityFinder}
+ * @author Jose Duarte
+ */
+public class TestEntityResIndexMapping {
private static final String PATH_TO_TEST_FILES = "/org/biojava/nbio/structure/io/";
@@ -67,7 +74,6 @@ public void test1SMT() throws IOException, StructureException {
params.setAlignSeqRes(true);
cache.setFileParsingParams(params);
-
StructureIO.setAtomCache(cache);
cache.setUseMmCif(false);
@@ -78,7 +84,11 @@ public void test1SMT() throws IOException, StructureException {
assertEquals("First residue in 1smtA "+chainA.getAtomGroup(0).toString()+" should map to 24 in SEQRES",24,i);
Chain chainB = s.getPolyChainByPDB("B");
i = chainB.getEntityInfo().getAlignedResIndex(chainB.getAtomGroup(0),chainB);
- assertEquals("First residue in 1smtB "+chainA.getAtomGroup(0).toString()+" should map to 20 in SEQRES",20,i);
+ assertEquals("First residue in 1smtB "+chainB.getAtomGroup(0).toString()+" should map to 20 in SEQRES",20,i);
+
+ // group with seqres index 19 is observed in chain B but not in chain A, we should still get the index back from getAlignedResIndex
+ i = chainA.getEntityInfo().getAlignedResIndex(chainA.getSeqResGroup(19),chainA);
+ assertEquals("Seqres residue 20 in 1smtA "+chainA.getSeqResGroup(19).toString()+" should map to 20 in SEQRES",20,i);
checkAllResidues(s);
}
@@ -97,17 +107,25 @@ private void checkAllResidues(Structure s) {
}
// This doesn't work yet, since for raw files without a SEQRES, the seqres groups are not populated. Instead
- // in that case Compound.getAlignedResIndex() returns residue numbers as given (without insertion codes) and
+ // in that case EntityInfo.getAlignedResIndex() returns residue numbers as given (without insertion codes) and
// thus in general residues will not be correctly aligned between different chains of same entity. This breaks
// cases like 3ddo (with no SEQRES records) where residue numbering is different in every chain of the one entity.
// see https://github.com/eppic-team/eppic/issues/39
- //@Test
+ @Ignore
+ @Test
public void test3ddoRawNoSeqres() throws IOException, StructureException {
// 3ddo has 6 chains in 1 entity, all of them with different residue numbering (chain A is 1000+, chain B 2000+ ...)
Structure s = getStructure("3ddo_raw_noseqres.pdb.gz", true);
- assertEquals(1,s.getEntityInfos().size());
+ List polyEntities = new ArrayList<>();
+ for (EntityInfo entityInfo : s.getEntityInfos()) {
+ if (entityInfo.getType() == EntityType.POLYMER) {
+ polyEntities.add(entityInfo);
+ }
+ }
+
+ assertEquals(1, polyEntities.size());
Chain chainA = s.getPolyChainByPDB("A");
Chain chainB = s.getPolyChainByPDB("B");
@@ -134,10 +152,17 @@ public void test3ddoRawNoSeqres() throws IOException, StructureException {
- // this should work either with or without setAlignSeqRes, since the mapping happens in CompoundFinder
+ // this should work either with or without setAlignSeqRes, since the mapping happens in EntityFinder
s = getStructure("3ddo_raw_noseqres.pdb.gz", false);
- assertEquals(1,s.getEntityInfos().size());
+ polyEntities = new ArrayList<>();
+ for (EntityInfo entityInfo : s.getEntityInfos()) {
+ if (entityInfo.getType() == EntityType.POLYMER) {
+ polyEntities.add(entityInfo);
+ }
+ }
+
+ assertEquals(1, polyEntities.size());
chainA = s.getPolyChainByPDB("A");
chainB = s.getPolyChainByPDB("B");
diff --git a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java
index f9915e47db..25436297a6 100644
--- a/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java
+++ b/biojava-structure/src/test/java/org/biojava/nbio/structure/TestExperimentalTechniques.java
@@ -31,7 +31,7 @@
public class TestExperimentalTechniques {
@Test
- public void test4LNC() throws IOException, StructureException {
+ public void test6F2Q() throws IOException, StructureException {
// a multiple experimental techniques PDB entry (X-RAY + NEUTRON DIFFRACTION)
@@ -40,9 +40,9 @@ public void test4LNC() throws IOException, StructureException {
StructureIO.setAtomCache(cache);
cache.setUseMmCif(false);
- Structure sPdb = StructureIO.getStructure("4LNC");
+ Structure sPdb = StructureIO.getStructure("6F2Q");
cache.setUseMmCif(true);
- Structure sCif = StructureIO.getStructure("4LNC");
+ Structure sCif = StructureIO.getStructure("6F2Q");
comparePdbToCif(sPdb, sCif);
diff --git a/biojava-survival/pom.xml b/biojava-survival/pom.xml
index 7ea9ba5a20..a90e42d981 100644
--- a/biojava-survival/pom.xml
+++ b/biojava-survival/pom.xml
@@ -4,7 +4,7 @@
org.biojava
biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-survival
diff --git a/biojava-ws/pom.xml b/biojava-ws/pom.xml
index 9dd4cd10e6..e7282143aa 100644
--- a/biojava-ws/pom.xml
+++ b/biojava-ws/pom.xml
@@ -3,7 +3,7 @@
biojava
org.biojava
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava-ws
biojava-ws
@@ -19,7 +19,7 @@
org.biojava
biojava-core
- 5.0.2-SNAPSHOT
+ 5.1.0
compile
diff --git a/pom.xml b/pom.xml
index 511ac005e9..a71b8756e6 100644
--- a/pom.xml
+++ b/pom.xml
@@ -12,7 +12,7 @@
org.biojava
biojava
pom
- 5.0.2-SNAPSHOT
+ 5.1.0
biojava
BioJava is an open-source project dedicated to providing a Java framework for processing biological
data. It provides analytical and statistical routines, parsers for common file formats and allows the
@@ -48,7 +48,7 @@
scm:git:git@github.com:biojava/biojava.git
https://github.com/biojava/biojava
- HEAD
+ biojava-5.1.0