Write a Python program called translate.py that translates a given DNA/RNA sequence to amino acids.
The input sequence is expected to be a positional argument.
The codon table is expected for the -c or --codons option and should be a valid, readable file.
The -o or --output option (default 'out.txt') will name a file to write the output.
When run with no inputs, the program should print a brief usage:
$ ./translate.py usage: translate.py [-h] -c FILE [-o FILE] str translate.py: error: the following arguments are required: str, -c/--codons
Or a longer usage for the -h or --help flags:
$ ./translate.py -h
usage: translate.py [-h] -c FILE [-o FILE] str
Translate DNA/RNA to proteins
positional arguments:
str DNA/RNA sequence
optional arguments:
-h, --help show this help message and exit
-c FILE, --codons FILE
A file with codon translations (default: None)
-o FILE, --outfile FILE
Output filename (default: out.txt)
The program should reject a --codons argument that fails to name a file:
$ ./translate.py -c lkdflk ACTG usage: translate.py [-h] -c FILE [-o FILE] str translate.py: error: argument -c/--codons: can't open 'lkdflk': \ [Errno 2] No such file or directory: 'lkdflk'
If given good input, write the results to the proper output file. Note here that the input string is lowercase:
$ ./translate.py -c codons.dna gaactacaccgttctcctggt Output written to "out.txt".
And now the out.txt file should contain the following:
$ cat out.txt ELHRSPG
Note that the -o flag should make the program write the output to a different file.
Note here that the input sequence is uppercase:
$ ./translate.py UGGCCAUGGCGCCCAGAACUG --codons codons.rna -o foo.txt Output written to "foo.txt".
Your program will be given the wrong codon table for a given sequence type, e.g., a DNA table for an RNA sequence:
$ ./translate.py UGGCCAUGGCGCCCAGAACUG --codons codons.dna Output written to "out.txt".
This means that your program will be unable to find some of the codons in which case it should print a - for a missing codon:
$ cat out.txt -P-RPE-
If you are creating a dictionary from the codon table, e.g.:
$ head -3 codons.rna AAA K AAC N AAG K
Such that you have something like this:
>>> codons = dict(AAA='K', AAC='N', AAG='K')
Everything is fine as long as you ask for codons that are defined but will fail at runtime if you ask for a codon that does not exist:
>>> codons['AAC'] 'N' >>> codons['AAT'] Traceback (most recent call last): File "<stdin>", line 1, in <module> KeyError: 'AAT'
What dictionary access method will prevent you from creating an exception if you ask for a key that doesn’t exist and will also allow you to set a default value?
A k-mer is a k-length sequence of contigous characters in a string (a "mer" like "polymer").
Here is a piece of code that you can use to extract all the 3-mers from the sequence seq:
>>> seq = 'actga' >>> k = 3 >>> for codon in [seq[i:i + k] for i in range(0, len(seq) - k + 1)]: ... print(codon) ... act ctg tga
You will then use the codon as a key to lookup the amino acid translation from the codons dictionary you build using the input file.
A passing test suite looks like this:
$ make test pytest -xv test.py ============================= test session starts ============================== ... collected 10 items test.py::test_exists PASSED [ 10%] test.py::test_usage PASSED [ 20%] test.py::test_no_args PASSED [ 30%] test.py::test_missing_input PASSED [ 40%] test.py::test_missing_codons PASSED [ 50%] test.py::test_bad_codon_file PASSED [ 60%] test.py::test_good_input1 PASSED [ 70%] test.py::test_good_input2 PASSED [ 80%] test.py::test_good_input3 PASSED [ 90%] test.py::test_good_input4 PASSED [100%] ============================== 10 passed in 0.50s ==============================