Skip to content

Navigation Menu

Sign in
Appearance settings

Search code, repositories, users, issues, pull requests...

Provide feedback

We read every piece of feedback, and take your input very seriously.

Saved searches

Use saved searches to filter your results more quickly

Appearance settings

OBF/FALDO

Open more actions menu

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

92 Commits
92 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

FALDO

FALDO is the Feature Annotation Location Description Ontology. It is a simple ontology to describe sequence feature positions and regions as found in GFF3, DDBJ, EMBL, GenBank files, UniProt, and many other bioinformatics resources.

The aim of this ontology is to describe the position of a sequence region or a feature. It does not aim to describe features or regions itself, but instead depends on resources such as the Sequence Ontology or the UniProt core ontolgy.

You can read more about it our paper describing FALDO

The ontology can be browsed here: http://biohackathon.org/resource/faldo or at http://aber-owl.net/ontology/FALDO/#/

Questions

Questions can be asked here using github issues, the google group, and BioStars. If using biostars please tag the question with 'faldo' so that it is easy for us to find.

Examples

The examples in turtle avoid declaring prefixes for space reasons.

Known positions

faldo:Region A genomic region where we know exactly where it starts and ends on the reference genome sequence:

_:1    a  faldo:Region ;
            faldo:begin _:1b ;
            faldo:end _:1e .

_:1b   a  faldo:ExactPosition, faldo:ForwardStrandPosition ;
            faldo:position 1 ;
            faldo:reference ddbj:XXXDSDS .

_:1e   a  faldo:FuzzyPosition, faldo:ForwardStrandPosition ;
            faldo:begin _:1ea ;
            faldo:end _:1eb ;
            faldo:reference ddbj:XXXDSDS .

_:1ea  a  faldo:ExactPosition, faldo:ForwardStrandPosition ;
            faldo:position 3 ;
            faldo:reference ddbj:XXXDSDS .

_:1eb  a  faldo:ExactPosition, faldo:ForwardStrandPosition ;
            faldo:position 7 ;
            faldo:reference ddbj:XXXDSDS .

A genomic region where the begin is on one contig and the end on an other:

@prefix faldo: <http://biohackathon.org/resource/faldo> .

_:2    a  faldo:Region ;
            faldo:begin _:2b ;
            faldo:end _:2e .
_:2b   a  faldo:ExactPosition ;
           faldo:position 1 ;
           faldo:reference _:contig17 .
_:2e   a  faldo:ExactPosition ;
           faldo:position 4 ;
           faldo:reference _:contig29 .

A rather crucial difference with most begin and end conventions here they are biological begin and end. Not smallest number is start and the larger number is end.

----->increasing count of position
123456789012345678901234567890
actgacgactagatcgatcgatcgactagt

tgactgctgatctagctagctagctgatca
     <----- direction of transcription 
     |    |--transcription on reverse strand begins here
     |--transcription on reverse strand ends here      

For example the cheY gene in Escherichia coli str. K-12 substr. MG1655 is described in the INSDC feature table as complement(1965072..1965461), which is 390 base pairs using inclusive one-based counting. In FALDO

@prefix faldo: <http://biohackathon.org/resource/faldo> .
@prefix refseq: <http://identifiers.org/refseq/> .
@prefix uniprot: <http://purl.uniprot.org/core/> .

_:geneCheY   a  <http://purl.obolibrary.org/obo/SO_0000704> ;  # A gene as defined by the Sequence Ontology.
                  rdfs:label "cheY" ;
                  faldo:location _:example .

uniprot:P0AE67 uniprot:encodedBy _:geneCheY .

_:example    a  faldo:Region ;
                  faldo:begin _:example_b ;
                  faldo:end _:example_e .

_:example_b  a  faldo:ExactPosition, faldo:ReverseStrandPosition ;
                  faldo:position 1965461 ;  # Note that the biological start position is numerically greater than the end position.
                  faldo:reference refseq:NC_000913.2 .

_:example_e  a  faldo:ExactPosition, faldo:ReverseStrandPosition ;
                  faldo:position 1965072 ;  # Note that the biological end position is numerically less than the start position.
                  faldo:reference refseq:NC_000913.2 .

Single position

In a case of single sequence position such as SNPs, faldo:location can directry refer to faldo:Position instead of faldo:Region.

@prefix faldo: <http://biohackathon.org/resource/faldo> .
@prefix refseq: <http://identifiers.org/refseq/> .

_:snp       a  <http://purl.obolibrary.org/obo/SO_0000694> ;
                 faldo:location _:pos .

_:pos       a  faldo:ExactPosition ;
                faldo:position 55505520 ;
                faldo:reference refseq:NC_000001.11 .

Fuzzy positions

Assume we have a protein aminoacid sequence "ACK" and a massspectrometry experiment says the amino acid A or C is glycosylated. But we don't know which of the two it is. We do know it is not "K".

@prefix faldo: <http://biohackathon.org/resource/faldo> .
@prefix glycan: <http://purl.jp/bio/12/glyco/glycan> .
@prefix uniprot: <http://purl.uniprot.org/core/> .

_:glysolyatedAminoAcid a glycan:glycosylated_AA ;  # The glycan ontology is used here.
                           faldo:location _:fuzzyPosition .
_:fuzzyPosition a        faldo:FuzzyPosition ,
                           faldo:InRangePosition ;
                           faldo:begin _:exactBegin ;
                           faldo:end   _:exactEnd .
_:faldoBegin a           faldo:ExactPosition ;
                           faldo:position 1 ;
                           faldo:refence _:sequence .
_:faldoEnd a             faldo:ExactPosition ;
                           faldo:position 2 ;
                           faldo:refence _:sequence .
_:sequence a             uniprot:Sequence ;
                           rdf:value "ACK" .

In the above example uniprot and glyco refer to the glycoprotein and uniprot schema's.

Probabilistic fuzzy positions

Here we have a begin position that could be one of two nucleotides. This case uses a probablisitic model that denotes that the feature could start at both positions 1 or 2. Position 1 has a likelihood of 0.1 and position 2 has a likelihood of 0.9. This is an extension to published FALDO that shows what is possible if one has this usecase.

@prefix faldo: <http://biohackathon.org/resource/faldo> .
@prefix probablisticfaldo: <http://example.org/resource/faldo> .

_:3 a    faldo:Region ;
           faldo:begin _:3b ;
           faldo:end _:3e .

_:3b a   faldo:ProbablePosition ;
           probablisticfaldo:posibilities ( _:3bp1 _:3bp2 ) .

_:3bp1 a faldo:ProbablePosition ;
           probablisticfaldo:probability 0.1e0 ;
           faldo:location _:3bb1 .

_:3bp2 a faldo:ProbablePosition ;
           probablisticfaldo:probability 0.9e0 ;
           faldo:location _:3bb2 .
_:3bb1 a faldo:Position ,
           faldo:ExactPosition ;
           faldo:position 1 ;
           faldo:reference _:1Strand .

_:3bb2 a faldo:Position ,
           faldo:ExactPosition ;
           faldo:position 2 ;
           faldo:reference _:1Strand .

License

Creative Commons License This work is licensed under a Creative Commons Zero 1.0 Public Domain Dedication.

Conversion into different RDF or XML formats

FALDO being maintained in faldo.ttl can be converted into RDF/XML using for example the rapper tools.

rapper -i turtle -o rdfxml-abbrev faldo.ttl > faldo.rdf

It can also be converted into rdfxml that can be transformed with the owl2xhtml.xsl stylesheet into a documentation webpage. For that the following code is helpfull.

xsltproc owl2xhtml.xsl faldo.rdf > faldo.html

About

Feature Annotation Location Description Ontology

Topics

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

Morty Proxy This is a proxified and sanitized view of the page, visit original site.